Arnica lonchophylla

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnica

At a glance

Occurrence records229

Data sources13

Biological traits8

DNA specimens8

eDNA detections5

Sources13 archives

Databases and archives Arnica lonchophylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS58 compounds

Occurrence & distributionGBIF229 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Arnica lonchophylla is a species of flowering plant in family Asteraceae. The common names for this species includes longleaf arnica, northern arnica, and spear-leaved arnica. It has daisy-like yellow flowers that are 2.5 to 5 cm across with a yellow center disks.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition58 compounds

Compounds documented for Arnica lonchophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ursane and Taraxastane triterpenoids22

Oleanane triterpenoids12

Lupane triterpenoids7

Flavonols4

Dammarane and Protostane triterpenoids $ Lupane triterpenoids4

Documented compounds58 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
[(1R,2R,5R,7S,10R,11R,14R,15S,16S,17S,19R,21S,22S)-22-hydroxy-1,2,6,6,10,16,17,21-octamethyl-18-oxahexacyclo[12.9.0.02,11.05,10.015,21.017,19]tricosan-7-yl] dodecanoate	present	LOTUS
[(1R,2R,5R,7S,10R,11R,14R,15S,16S,17S,19R,21S,22S)-22-hydroxy-1,2,6,6,10,16,17,21-octamethyl-18-oxahexacyclo[12.9.0.02,11.05,10.015,21.017,19]tricosan-7-yl] hexadecanoate	present	LOTUS
[(1R,2R,5R,7S,10R,11R,14R,15S,16S,17S,19R,21S,22S)-22-hydroxy-1,2,6,6,10,16,17,21-octamethyl-18-oxahexacyclo[12.9.0.02,11.05,10.015,21.017,19]tricosan-7-yl] octadecanoate	present	LOTUS
[(1R,2R,5R,7S,10R,11R,14R,15S,16S,17S,19R,21S,22S)-22-hydroxy-1,2,6,6,10,16,17,21-octamethyl-18-oxahexacyclo[12.9.0.02,11.05,10.015,21.017,19]tricosan-7-yl] tetradecanoate	present	LOTUS
[(1R,3aS,4S,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bR)-4-hydroxy-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-yl] dodecanoate	present	LOTUS
[(1R,3aS,4S,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bR)-4-hydroxy-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-yl] hexadecanoate	present	LOTUS
[(1R,3aS,4S,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bR)-4-hydroxy-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-yl] tetradecanoate	present	LOTUS
[(1R,3aS,4S,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bR)-4-hydroxy-3a-(hydroxymethyl)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-yl] dodecanoate	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica lonchophylla has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218377.1 ↗349 bpCanada · 1996

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Arnica lonchophylla voucher BAB-0379 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnica lonchophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidypolyploid inferred

Chromosome records56–762n range66median56mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 572×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1987. Cytotaxonomic studies in the genus Arnica (Compositae: Senecioneae). Rhodora 89: 391–400.

n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type229 records

Wild obs. + sensor37

Museum / vouchered192

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 11≤1 km 5≤10 km 2>10 km 8

26 georeferenced · 11 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 16≤1 km 24≤10 km 20>10 km 4

64 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	36
Spearfish, US	24
Montréal, CA	23
Bronx, US	18
Université Lavallocation not on record	17
Wuzhou, CN	15
University of Alberta Museumslocation not on record	14
Stockholm, SE	8
Whitehorse, CA	5
Vancouver, CA	3
University of Lethbridgelocation not on record	3
USFS/BHSClocation not on record	3
Olocation not on record	3
WINlocation not on record	3
Research Collection of B. A. Bennettlocation not on record	2
Moscow, US	2
Beijing, CN	1
Provo, US	1
New Brunswick, US	1
Victoria, CA	1
BRNUlocation not on record	1
University of Wisconsinlocation not on record	1
Saint John, CA	1
Yukon Universitylocation not on record	1
Bangkok, TH	1

25 institutions · 188 of 192 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Arnica lonchophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 13.3–15.7

Seasonal swing summer↔winter32.2 °C

Max temp (day)17.7 °C 17.3–20.5

Min temp (night)9.20 °C 8.50–10.1

Precipitation64.1 mm/mo 60.3–71.3

Air humidity55.2 % 53.6–57.4

Moisture balance-51.6 mm/mo -72.3–-42.6

Vapour deficit717 Pa 653–833

Wind speed3.80 m/s 2.40–4.00

Cloud cover41.1 % 39.7–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)