Arnica lessingii

(Torr. & A.Gray) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnica

At a glance

Occurrence records530

Data sources13

Biological traits16

DNA specimens13

eDNA detections5

Sources13 archives

Databases and archives Arnica lessingii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility530 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF530 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Arnica lessingii is a Russian and North American species of arnica in the sunflower family. The common name is nodding arnica.Flora of North America Vol. 21 Page 369 Nodding arnica, Arnica lessingii (Torrey & A. Gray) Greene It is found on both sides of the Bering Strait, being native to Alaska, Yukon, British Columbia, Northwest Territories, and the Kamchatka Peninsula of the Pacific Coast of Russia.Biota of North America Program 2014 state-level distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.4 m

Plant height min0.06 m

Seed mass0.966 mg

Seed mass max0.96 mg

Seed mass min0.96 mg

Life cycle & reproduction3

Flowering endJul

Flowering startJul

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Arnica lessingii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Merohemiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
6-Acetyl-2,2-dimethyl-2H-1-benzopyran		present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica lessingii has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes6

GenBank sequences7

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG220159.1 ↗350 bpCanada · 2005

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Arnica lessingii voucher BAB-5055 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnica lessingii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidy2× diploid · measured

Chromosome records38–762n range76median76mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 764×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · iapt — IAPT/IOPB Chromosome Data 5

CCDB · ipcn-api-dl — Downie, S. R. 1985. Chromosome Number Reports LXXXVIII. Taxon 34: 547–551.

CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.

2n 383×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Love, A. & D. Love. 1975a. In IOPB chromosome number reports L. Taxon 24: 671–678.

CCDB · book-ipcn67-71 — KNABEN, G. 1968. Chromosome numbers of flowering plants from Central Alaska. Nytt mag. bot. 15: 240-254.

CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.

2n 571×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type530 records

Wild obs. + sensor207

Museum / vouchered323

Range

Area of Occupancy AOO1 636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 80≤1 km 29≤10 km 18>10 km 23

150 georeferenced · 57 without coordinates

Open the mapobservation + sensor207

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 7≤1 km 12≤10 km 37>10 km 43

99 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence323

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	40
Vancouver, CA	34
Anchorage, US	32
WTUlocation not on record	24
Moscow State Universitylocation not on record	23
Provo, US	21
University of Alberta Museumslocation not on record	21
University of Stellenboschlocation not on record	18
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	18
Stockholm, SE	14
Yukon Universitylocation not on record	11
Bronx, US	7
St. Paul, US	6
Chongqing Museumlocation not on record	6
Whitehorse, CA	5
Olocation not on record	5
Flagstaff, US	4
Tempe, US	4
Davis, US	2
BRNUlocation not on record	2
Research Collection of B. A. Bennettlocation not on record	2
Wuzhou, CN	2
Montréal, CA	2
Göteborg, SE	2
TROMlocation not on record	1
Millersville, US	1
University of Lethbridgelocation not on record	1
Phoenix, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Université Lavallocation not on record	1
Moscow, US	1
Corvallis, US	1
Pullman, US	1
Albuquerque, US	1
Tromso University Museumlocation not on record	1
Frankfurt am Main	1
Turlock, US	1
Acadia Universitylocation not on record	1
Canadian Museum of Naturelocation not on record	1
Trondheim, NO	1

40 institutions · 321 of 323 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Arnica lessingii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Cushion Shrub (Salix polaris) - Moss Snowbank

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C 3.80–11.0

Seasonal swing summer↔winter33.0 °C

Max temp (day)11.6 °C 7.10–14.7

Min temp (night)4.90 °C -0.4–7.40

Precipitation113 mm/mo 87.5–150

Air humidity60.2 % 59.5–63.1

Moisture balance21.2 mm/mo -0.1–47.0

Vapour deficit427 Pa 310–529

Wind speed5.20 m/s 3.60–8.20

Cloud cover59.7 % 47.5–71.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)