Arnica griscomii

Fernald · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnica

At a glance

Occurrence records160

Data sources11

Biological traits14

DNA specimens10

eDNA detections12

Sources11 archives

Databases and archives Arnica griscomii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Arnica griscomii is an Asian and North American species of plants in the sunflower family, known by the common name snow arnica.Flora of North America, Snow arnica , Arnica griscomii It is native to eastern Russia and northwestern North America (Alaska, British Columbia, Yukon, Northwest Territories) and to eastern Canada (Quebec and Newfoundland).Biota of North America Program 2014 state-level distribution map Subspecies Arnica griscomii subsp. frigida (C.A.Mey. ex Iljin) S.J.Wolf - Alaska, western Canada, eastern Russia Arnica griscomii subsp. griscomii - Quebec and Newfoundland

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology4

Plant height0.3 m

Plant height max0.3 m

Plant height min0.05 m

Seed mass1.33 mg

Life cycle & reproduction3

Flowering endAug

Flowering startJul

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows, rivers, sand, shores, stony places, tundra

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica griscomii has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219668.1 ↗348 bpUSA · 2002

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Arnica griscomii voucher BAB-3536 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnica griscomii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidypolyploid inferred

Chromosome records58–762n range76median76mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 765×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · eflora

CCDB · ipcn-api-dl — ZHUKOVA, P. G., A. A. KOROBKOV & A. D. TIKHONOVA. 1977. Chromosome numbers of some plant species in the eastern Arctic Yakuta. Bot. Žhurn. (Moscow & Leningrad) 62(2): 229–234.

CCDB · ipcn-api-dl — GERVAIS, C. 1979a. Liste annotee de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique. Naturaliste Canad. 106: 451–461.

CCDB · ipcn-api-dl — Downie, S. R. & K. E. Denford. 1986. The taxonomy of Arnica frigida and A. louiseana (Asteraceae). Canad. J. Bot. 64: 1355–1372.

CCDB · book-ipcn75-78 — Zhukova et al. 1977

CCDB · eflora

2n 602×CCDB · book-ipcn65 · CCDB · book-ipcn67-71

CCDB · book-ipcn65 — Zhukova 1965a

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

2n 571×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

2n 581×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.

2n 701×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.

n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type160 records

Wild obs. + sensor105

Museum / vouchered55

Origin

Native4

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 58≤1 km 4≤10 km 2>10 km 8

72 georeferenced · 33 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	40
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Université Lavallocation not on record	3
Canadian Museum of Naturelocation not on record	2
Research Collection of B. A. Bennettlocation not on record	2
Bronx, US	1
Chongqing Museumlocation not on record	1

7 institutions · 53 of 55 vouchered records shown · 2 without an institution code

09Environmental DNA12 detections

Where the DNA of Arnica griscomii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

Rich alpine meadow upper slope sed..Submesic Herb - Dryas Heath Tundra with spar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 5.40–12.2

Seasonal swing summer↔winter38.8 °C

Max temp (day)14.9 °C 9.20–16.1

Min temp (night)6.50 °C 0.6–7.70

Precipitation84.9 mm/mo 67.6–146

Air humidity59.9 % 59.4–64.3

Moisture balance7.60 mm/mo

Vapour deficit524 Pa 352–574

Wind speed4.20 m/s

Cloud cover57.7 % 46.1–67.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)