Arnica cordifolia
Hook. · speciesAt a glance
Occurrence records9 181
Data sources13
Biological traits95
DNA specimens17
eDNA detections8
Sources13 archives
Databases and archives Arnica cordifolia's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 181 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources95 traits
Chemical compositionLOTUS · NPASS12 compounds
Occurrence & distributionGBIF9 181 records
Environmental DNA1 datasets · 2 countries8 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB2n = 76
01Narrative
Arnica cordifolia is a species of arnica in the sunflower family, known by the common name heartleaf arnica.Calflora taxon report, University of California, Arnica cordifolia Hook. heart leaved arnica, heartleaf arnica It is native to western North America.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTUSDATRY
Size & morphology5
Leaf size1 340 mm²
Plant height0.46 m
⚠ sources differ — GIFT: 0.46 m · USDA: 0.457 m · TRY: 0.21 m
Seed mass1.26 mg
⚠ sources differ — TRY: 1.26 mg · GIFT: 1.63 mg
Seed mass max1.34 mg
Seed mass min0.9 mg
Life cycle & reproduction25
After harvest regrowth rateRapid
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
Flower colouryellow
Flower conspicuousYes
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life spanperennial
Lifespan categoryShort
Lifespan years3 years
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormYes
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateRapid
Seedling vigorHigh
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment23
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourwhite
Growth formherb
Growth form USDARhizomatous
Hedge toleranceHigh
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min130 days
Moisture useHigh
Nitrogen fixation levelNone
Precipitation max35 in
Precipitation min10 in
Protein potentialMedium
Salinity toleranceNone
Shade toleranceLow
Soil pH max8 pH
Soil pH min6 pH
Specific leaf area (SLA)17.94 mm²/mg
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound220 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min1 200 per acre
03Chemical composition12 compounds
Compounds documented for Arnica cordifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Flavones5
Pseudoguaiane sesquiterpenoids4
Flavonols4
Carabrane sesquiterpenoids1
Documented compounds12 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2,3-Dihydroaromaticin | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 3,4',5,7-Tetrahydroxy-6-methoxyflavone | present | LOTUS | |
| 6-Methylscutellarein | present | LOTUS | |
| Astragalin | present | LOTUS | |
| Carabron | present | LOTUS | |
| Chrysoeriol | present | LOTUS | |
| Eupafolin | present | LOTUS | |
| Genkwanin | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica cordifolia has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes6
GenBank sequences10
eDNA detections8
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Arnica cordifolia voucher BAB-4239 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL3★rbcLa★trnL-F★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Arnica cordifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 76 n = 38
Ploidypolyploid inferred
Chromosome records60–762n range76median76mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 764×CCDB · ipcn-api-dl · CCDB · book-fedorov
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — Taylor, J. A. & R. TANAKA. 1977. Nuclear behavior in the megagametogenesis and embryogenesis of Pogonia japonica. CIS Chromosome Inform. Serv. 23: 11–12.
CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.
CCDB · book-fedorov — Taylor R., L. Brockman 1966
2n 571×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Wolf, S. J. 1987. Cytotaxonomic studies in the genus Arnica (Compositae: Senecioneae). Rhodora 89: 391–400.
2n 601×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
2n 951×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.
n 383×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Taylor, J. A. & R. TANAKA. 1977. Nuclear behavior in the megagametogenesis and embryogenesis of Pogonia japonica. CIS Chromosome Inform. Serv. 23: 11–12.
CCDB · book-ipcn66 — Taylor & Broclanan 1966
CCDB · book-ipcn67-71 — ORNDUFF, R., T. MOSQUIN, D. W. KYHOS, & P. H. RAVEN. 1967. Chromosome numbers in Compositae. VI. Senecioneae. II. Am. Jour. Bot. 54: 205-213.
n 192×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Wolf, S. J. & K. E. Denford. 1984. Taxonomy of Arnica (Compositae) subgenus Austromontana. Rhodora 86: 239–309.
CCDB · book-ipcn73-74 — CHAACK, C.G., J.T. WITHERSPOON, & T.J. WATSON. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 181 records
Wild obs. + sensor5 910
Museum / vouchered3 271
Origin
Native19
Range
Area of Occupancy AOO21 728 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 3 674≤1 km 566≤10 km 283>10 km 172
4 695 georeferenced · 1 215 without coordinates
Open the mapobservation + sensor5 910
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 200≤1 km 599≤10 km 660>10 km 83
1 542 georeferenced · 1 729 without coordinates
Open the institutions mapphysical evidence3 271
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions77 of 123 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 274 |
| University of Alberta Museumslocation not on record | 251 |
| Pullman, US | 205 |
| Vancouver, CA | 193 |
| Moscow, US | 183 |
| Corvallis, US | 160 |
| WTUlocation not on record | 155 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 154 |
| Missoula, US | 135 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 129 |
| Boise, US | 103 |
| Denver, US | 100 |
| Logan, US | 71 |
| Bozeman, US | 63 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 59 |
| Pocatello, US | 56 |
| Wuzhou, CN | 53 |
| Victoria, CA | 48 |
| Arcata, US | 41 |
| Provo, US | 36 |
| Caldwell, US | 36 |
| CASlocation not on record | 34 |
| Flagstaff, US | 31 |
| University of Lethbridgelocation not on record | 30 |
| Rocky Mountain Biological Laboratorylocation not on record | 28 |
| DOI/NPS, Greenbelt Parklocation not on record | 27 |
| Chongqing Museumlocation not on record | 26 |
| Durango, US | 24 |
| Albuquerque, US | 24 |
| Riverside, US | 23 |
| Saint Louis, US | 21 |
| Claremont, US | 20 |
| Cheney, US | 20 |
| Orem, US | 19 |
| Angwin, US | 19 |
| Weber State Universitylocation not on record | 18 |
| Spearfish, US | 18 |
| Davis, US | 16 |
| Chadron, US | 15 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 14 |
| Turlock, US | 14 |
| Bloomington, US | 12 |
| Pittsburg, US | 11 |
| Yukon Universitylocation not on record | 10 |
| Stockholm, SE | 10 |
| USFS/BHSClocation not on record | 9 |
| San Luis Obispo, US | 9 |
| Phoenix, US | 8 |
| University of Stellenboschlocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Ashland, US | 8 |
| Grand Junction, US | 7 |
| Tempe, US | 7 |
| Montréal, CA | 6 |
| Moscow State Universitylocation not on record | 6 |
| Bend, US | 6 |
| St. Paul, US | 5 |
| Whitehorse, CA | 5 |
| Portland, US | 5 |
| EL PASO, US | 4 |
| Emporia, US | 4 |
| Northridge, US | 4 |
| IDElocation not on record | 4 |
| Tacoma, US | 4 |
| Santa Barbara, US | 4 |
| San Francisco, US | 4 |
| ASUlocation not on record | 4 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 4 |
| Henderson, US | 4 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Lubbock, US | 3 |
| Davenport, US | 3 |
| San Diego, US | 3 |
| AUAlocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Bangkok, TH | 3 |
| Dekalb, US | 3 |
| Lincoln, US | 3 |
| Pacific Lutheran Universitylocation not on record | 3 |
| San Angelo, US | 3 |
| Irvine, US | 2 |
| SEFlocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Long Beach, US | 2 |
| Université Lavallocation not on record | 2 |
| Madison, US | 2 |
| USFSlocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| China Agricultural Universitylocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| INFlocation not on record | 2 |
| San Jose, US | 2 |
| Québec, CA | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| STNFlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Mexico City, MX | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Johnson City, US | 1 |
| GB | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| Brookings, US | 1 |
| Acadia Universitylocation not on record | 1 |
| KNFHClocation not on record | 1 |
| Truckee, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Millersville, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Philadelphia, US | 1 |
| US | 1 |
| Burlington, US | 1 |
| US | 1 |
| Honolulu, US | 1 |
| Cslocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Kew, GB | 1 |
| Richmond, US | 1 |
| Beijing, CN | 1 |
| Bourges, FR | 1 |
| US | 1 |
| Riyadh Municipalitylocation not on record | 1 |
123 institutions · 3 216 of 3 271 vouchered records shown · 55 without an institution code
09Environmental DNA8 detections
Where the DNA of Arnica cordifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map2 countries0
Shaded hillside with Geranium, Pinus, Rubus
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.9 °C 7.90–16.1
Seasonal swing summer↔winter28.3 °C
Max temp (day)19.1 °C 12.4–21.5
Min temp (night)6.50 °C 1.70–9.90
Precipitation76.8 mm/mo 34.6–85.6
Air humidity53.5 % 49.1–55.3
Moisture balance-59.9 mm/mo -78.5–-36.5
Vapour deficit738 Pa 495–852
Wind speed2.50 m/s 1.50–4.30
Cloud cover39.0 % 29.0–42.9
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.