Arnebia decumbens

(Vent.) Coss. & Kralik · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Arnebia

At a glance

Occurrence records822

Data sources9

Biological traits32

DNA specimens38

eDNA detections15

Sources9 archives

Databases and archives Arnebia decumbens's data was compiled from.

GBIFGlobal Biodiversity Information Facility822 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources32 traits

Chemical compositionNPASS60 compounds

Occurrence & distributionGBIF822 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD · NCBI38 specimens

Genome at a glanceCCDB2n = 22

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length2 mm

Fruit length max2 mm

Fruit length min2 mm

Leaf length40 mm

Leaf length max60 mm

Leaf length min20 mm

Leaf width9 mm

Leaf width max16 mm

Leaf width min2 mm

Plant height max0.2 m

Plant height min0.05 m

Seed mass9.19 mg

Seed mass max9.19 mg

Seed mass min9.19 mg

Life cycle & reproduction6

Flowering endApr

Flowering startFeb

Life formannual

Life spanannual

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max3 000 m

Elevation min500 m

Growth formherb

Habitat GIFTdesert, mountains, sand, semidesert, stony places

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Leaf dry-matter content (LDMC)402 mg/g

Other traits1

Plant support typefree-standing

03Chemical composition60 compounds

Compounds documented for Arnebia decumbens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

N-acyl amines4

Guaiane sesquiterpenoids3

Flavones2

Stigmastane steroids2

Ursane and Taraxastane triterpenoids1

Documented compounds60 total

Tissue Source Quantified only

Compound	Amount	Source
(2E,4E)-1-(3,4-dihydro-2H-pyridin-1-yl)undeca-2,4-dien-8,10-diyn-1-one	present	NPASS
(2E,4E)-N-isobutylundeca-2,4-dien-8,10-diynamide	present	NPASS
(2E,4E,6E)-N-Isobutyl-7-(2-Thienyl)-2,4,6-Heptatrienamide	present	NPASS
(2E,4E,6E)-N-Isopentyl-7-(2-Thienyl)-2,4,6-Heptatrienamide	present	NPASS
(2E,4E,8Z)-N-isobutyltetradeca-2,4,8-trienamide	present	NPASS
(2Z)-5-{[(2E,4E,6E)-7-(2-Thienyl)-2,4,6-Heptatrienoyl]Amino}-2-Pentenyl 3-Methylbutanoate	present	NPASS
1-(5-Acetyl-2-methoxy-phenyl)-3-methyl-butan-1-one	present	NPASS
1-[(2E,4E)-Tetradecadienoyl]Piperidine	present	NPASS
1-[(2E,4E,6E)-7-(2-Thienyl)-2,4,6-Heptatrienoyl]-2,3-Dehydropiperidine	present	NPASS
1-[(2E,4E,6E)-7-(2-Thienyl)-2,4,6-Heptatrienoyl]Piperidine	present	NPASS

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnebia decumbens has left across the world's sequence archives.

At a glance

DNA specimens38

Marker genes5

GenBank sequences10

eDNA detections15

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR473692.1 ↗452 bpTunisia

ACGT

CTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTAAAGGCACGTCTGCCTGGG …

Arnebia decumbens isolate R 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnebia decumbens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aryavand, A. 1975. Contribution a l'etude cytotaxonomique de quelques angiospermes de l'Iran. Bot. Not. 128: 299–311.

n 112×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ghaffari, S. M. 1996. Chromosome studies in some species of Boraginaceae from Iran. Iran. J. Bot. 7(1): 81–93.

CCDB · ipcn-api-dl — Aryavand, A. 1975. Contribution a l'etude cytotaxonomique de quelques angiospermes de l'Iran. Bot. Not. 128: 299–311.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.734 ↗

08Occurrence & distribution

Record type822 records

Wild obs. + sensor507

Museum / vouchered293

Other22

Range

Area of Occupancy AOO2 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 108≤1 km 22≤10 km 85>10 km 5

220 georeferenced · 287 without coordinates

Open the mapobservation + sensor507

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 30≤1 km 16≤10 km 50>10 km 6

102 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence293

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GMBAlocation not on record	37
Moscow State Universitylocation not on record	32
Academy of Sciences of the Republic of Uzbekistanlocation not on record	20
Urumqi, CN	17
Kew, GB	11
Herbarium of South China Botanical Gardenlocation not on record	11
Paris, FR	10
Edinburgh, GB	9
Beijing, CN	8
Wlocation not on record	7
Nanjing, CN	5
Kunming, CN	5
Berlin, DE	4
Yangling, CN	4
BRNUlocation not on record	3
Bratislava, SK	3
Uniwersytet Opolskilocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
Guangzhou, CN	3
Phyletisches Museum Jenalocation not on record	2
LDlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
MAlocation not on record	2
Voronezh State Universitylocation not on record	2
Chengdu, CN	2
València, ES	2
BClocation not on record	2
Durham, US	2
MeiseBGlocation not on record	2
Rishon Le Zion, IL	1
Logan, US	1
Podgorica, ME	1
Frankfurt am Main	1
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	1
Oskarshamn, SE	1
Turpan Eremophytes Botanical Garden, Herbariumlocation not on record	1
PRClocation not on record	1
Urumqi, CN	1
Bloomington, US	1
Salamanca, ES	1
Barcelona, ES	1
Uppsala, SE	1
Adam Mickiewicz University in Poznańlocation not on record	1

43 institutions · 229 of 293 vouchered records shown · 63 without an institution code

09Environmental DNA15 detections

Where the DNA of Arnebia decumbens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 7.00–21.9

Seasonal swing summer↔winter34.4 °C

Max temp (day)24.0 °C 12.1–26.9

Min temp (night)9.20 °C -0.9–15.2

Precipitation25.2 mm/mo 14.0–55.8

Air humidity48.6 % 41.0–54.6

Moisture balance-117 mm/mo -157–-64.9

Vapour deficit1,135 Pa 461–1,524

Wind speed3.30 m/s 1.90–4.70

Cloud cover35.6 % 30.4–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)