Armillaria socialis — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Physalacriaceae/Armillaria

At a glance

Occurrence records6

Data sources9

Biological traits0

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Armillaria socialis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Armillaria socialis is a species of fungus in the family Physalacriaceae. It is a plant pathogen. Originally described by Augustin Pyramus de Candolle in 1815, it was transferred to Armillaria by Victor Fayod in 1889. It is found in Asia, Europe, and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Armillaria socialis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ784802.1 ↗622 bpFrance

ACGT

GAAACTTGAATCGTAGCTATGGAGAACTGTTGCTGACCCGCAAGGGTATGTGCACGTTTGAAGTGTTGCGTTTTATTCATCCACCTGTGC …

Armillaria socialis strain T4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS4

fungal barcode

08Occurrence & distribution

Record type6 records

Museum / vouchered6

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

10Collections & institutions

Institution	Specimens
BDBClocation not on record	1
BRNUlocation not on record	1

2 institutions · 2 of 6 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Armillaria socialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 8.30–11.3

Seasonal swing summer↔winter17.6 °C

Max temp (day)13.5 °C 11.9–15.1

Min temp (night)5.80 °C 4.40–7.30

Precipitation67.0 mm/mo 57.6–76.5

Air humidity62.4 % 62.3–62.5

Moisture balance-8.80 mm/mo -9.50–-8.00

Vapour deficit512 Pa 471–552

Wind speed4.00 m/s 3.40–4.60

Cloud cover41.8 % 41.7–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.