Armillaria obscura — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Physalacriaceae/Armillaria

At a glance

Occurrence records56

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Armillaria obscura's data was compiled from.

GBIFGlobal Biodiversity Information Facility56 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF56 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Armillaria obscura has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH855230.1 ↗769 bp

ACGT

ATCGCAGCATTGAGACTGTTGCTGACCTGTTAAGGGTATGTGCACGTTCGACGTGTTGCGTTCTATTCATCCACCTGTGCATCTTTGTAG …

Armillaria obscura strain CBS 107.32 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor32

Museum / vouchered23

Other1

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 27>10 km 2

31 georeferenced · 1 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Łódzkilocation not on record	12
MAlocation not on record	2
Görlitz, DE	2
Chicago, US	2
BDBClocation not on record	1
GJOlocation not on record	1
ILLSlocation not on record	1
Karlsruhe, DE	1
DPIlocation not on record	1

9 institutions · 23 of 23 vouchered records shown