Armeria welwitschii

Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Plumbaginaceae/Armeria

At a glance

Occurrence records541

Data sources10

Biological traits7

DNA specimens9

eDNA detections9

Sources10 archives

Databases and archives Armeria welwitschii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility541 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF541 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Armeria welwitschii is a species of flowering plant in the thrift family (Plumbaginaceae), endemic to central coastal Portugal. It is often cultivated as an ornamental in rock gardens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass2.28 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Armeria welwitschii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB979589.1 ↗598 bp

ACGT

TCGAAACCTGCAAAAGCAGAGCCACGTGTGAACTTGTTTTAAACCATCCCTTGTTGTGGTGTGGACGGCTGCATTGTGCATCCTCCATCC …

Armeria welwitschii gene for ITS1, 5.8S rRNA, ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Armeria welwitschii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1811×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4

CCDB · iber-fl — tude caryologique du genre Armeria Willd. Pierre Donadille, M.C.R. Acad. Sci. Paris264: 813-816(1967).

CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 1-15. Queirs, M.Bol. Soc. Brot. ser. 252: 69-77(1978).

CCDB · fl-europaea — Donadille, 1967

CCDB · ipcn-api-dl — Caixinhas, L., T. Vasconcelos, J. Monjardino, A. D. Barão, C. P. Ricardo & J. N. Martins. 1991. Situation actuelle de la banque de germplasme des espèces endémiques du Portugal. Bot. Chron. (Patras) 10: 603–608.

CCDB · book-ipcn67-71 — SUDA, Y. 1969. Karyotypes of some taxa in Armeria. Sci. Rep. Tohoku Univ. Ser. 4 (Biol.) 35: 21-31.

CCDB · book-ipcn75-78 — Queiros 1978

CCDB · book-fedorov — Phillips 1938

CCDB · book-fedorov — Sugiura 1937c, 1939a

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type541 records

Wild obs. + sensor493

Museum / vouchered47

Cultivated / captive1

Origin

Native81

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 128≤1 km 66≤10 km 105>10 km 10

309 georeferenced · 184 without coordinates

Open the mapobservation + sensor493

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 6≤1 km 3≤10 km 3

12 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence47

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ISAlocation not on record	17
València, ES	4
MAlocation not on record	3
Entomological Society of Latvialocation not on record	3
Museo Achille Folettolocation not on record	2
Wlocation not on record	2
Barcelona, ES	1
Podgorica, ME	1
BRNUlocation not on record	1
CICYTEXlocation not on record	1
Badajoz, ES	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Vitoria, ES	1
Coimbra, PT	1

14 institutions · 39 of 47 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Armeria welwitschii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)