Armeria pungens

(Brot.) Hoffmanns. & Link · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Plumbaginaceae/Armeria

At a glance

Occurrence records2 092

Data sources11

Biological traits10

DNA specimens184

eDNA detections182

Sources11 archives

Databases and archives Armeria pungens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 092 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI182 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics184 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF2 092 records

Environmental DNA1 datasets · 4 countries182 detections

DNA & barcodingBOLD · NCBI184 specimens

Genome at a glanceCCDB · GoaT · NCBI≈4.3 Gbp

01Narrative

Armeria pungens, common name spiny thrift, is a rare plant of the genus Armeria of the family Plumbaginaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.05 m

Seed mass2.66 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Lifespan years2 years

Habitat & environment3

Climatetemperate

Growth formshrub

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding184 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Armeria pungens has left across the world's sequence archives.

At a glance

DNA specimens184

Marker genes3

GenBank sequences10

eDNA detections182

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMK547351.1 ↗617 bp

ACGT

ATTGTCGAAACCTGCAAAAGCAGAGCCACGTGTGAACTTGTTTTAAACCATCCCTTGTTGTGGTGTGGACGGCTGCATTGTGCATCCTCC …

Armeria pungens voucher GN4723-12 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★ITS10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Armeria pungens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈4 329 991 736 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Armeria pungens4.33 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1810×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +2

CCDB · ita-fl — ARRIGONI P.V. - 1970. Contributo alla conoscenza delle Armerie sardo-corse.. Webbia , 25: 137-182.

CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).

CCDB · iber-fl — tude caryologique du genre Armeria Willd. Pierre Donadille, M.C.R. Acad. Sci. Paris264: 813-816(1967).

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 1-34. Valds Bermejo, E.Anales Jard. Bot. Madrid36: 373-389(1980).

CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).

CCDB · ipcn-api-dl — Valdes-Bermejo, E. 1980. Numeros cromosomaticos de plantas occidentales. 1-34. Anales Jard. Bot. Madrid 36: 373–389.

CCDB · ipcn-api-dl — Caixinhas, L., T. Vasconcelos, J. Monjardino, A. D. Barão, C. P. Ricardo & J. N. Martins. 1991. Situation actuelle de la banque de germplasme des espèces endémiques du Portugal. Bot. Chron. (Patras) 10: 603–608.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.

CCDB · book-fedorov — Phillips 1938

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 092 records

Wild obs. + sensor1 658

Museum / vouchered423

Other11

Origin

Native12

Range

Area of Occupancy AOO1 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 626≤1 km 209≤10 km 278>10 km 26

1 139 georeferenced · 519 without coordinates

Open the mapobservation + sensor1 658

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤1 km 29≤10 km 32

64 georeferenced · 359 without coordinates

Open the institutions mapphysical evidence423

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut und Museum fuer Geologie und Palaeontologielocation not on record	47
ISAlocation not on record	44
MAlocation not on record	31
College of the Atlantic, Museumlocation not on record	11
CICYTEXlocation not on record	8
Barcelona, ES	8
Wlocation not on record	7
CJBGlocation not on record	7
Badajoz, ES	6
JBSlocation not on record	6
Alicante, ES	5
Entomological Society of Latvialocation not on record	4
BIO-UNIPIlocation not on record	4
València, ES	4
MeiseBGlocation not on record	3
Museo Achille Folettolocation not on record	3
Vitoria, ES	3
Salamanca, ES	3
Madrid, ES	2
Berlin, DE	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Sevilla, ES	2
BClocation not on record	2
Granada, ES	2
BRNUlocation not on record	1
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
Sevilla, ES	1
Tilburg, NL	1
ESP003location not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Vancouver, CA	1

31 institutions · 223 of 423 vouchered records shown · 31 without an institution code

09Environmental DNA182 detections

Where the DNA of Armeria pungens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found182

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 182 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.3–15.4

Seasonal swing summer↔winter19.6 °C

Max temp (day)20.1 °C 15.1–20.5

Min temp (night)9.00 °C 7.30–10.4

Precipitation70.4 mm/mo 33.4–76.5

Air humidity57.7 % 52.9–62.5

Moisture balance-28.0 mm/mo -61.7–-8.00

Vapour deficit804 Pa 552–953

Wind speed2.60 m/s 2.00–4.60

Cloud cover40.9 % 38.3–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 179 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Armeria pungens

At a glance

Sources11 archives

Size & morphology2

Life cycle & reproduction3

Habitat & environment3

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 092 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 092 records