Armeria maritima
(Mill.) Willd. · speciesAt a glance
Occurrence records126 036
Data sources12
Biological traits122
DNA specimens53
eDNA detections32
Sources12 archives
Databases and archives Armeria maritima's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility125 795 records↗
OBISOcean Biodiversity Information System241 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics53 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources122 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF · OBIS126 036 records
Environmental DNA1 datasets · 9 countries32 detections
DNA & barcodingBOLD · NCBI53 specimens
Genome at a glanceCCDB · GoaT4.4 Gbp
01Narrative
L'Armérie maritime, œillet marin, gazon d'Espagne, est une espèce de plantes herbacées vivaces de la famille des Plumbaginaceae. Halophyte strictement littorale, elle est à répartition boréo-subocéanique. En France, elle est rencontrée sur les côtes de la Manche et de l'Atlantique, sur les rochers et pelouses de bords de mer, battus par les embruns.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology10
Leaf mass7.68 mg
Leaf size157 mm²
⚠ sources differ — TRY: 157 mm² · GIFT: 98.88 mm²
Plant height0.169 m
⚠ sources differ — GIFT: 0.169 m · LEDA: 0.15 m · USDA: 0.274 m · TRY: 0.15 m
Plant height generative0.15 m
Plant height max0.5 m
Plant height min0.05 m
Seed length4.25 mm
Seed mass1.35 mg
⚠ sources differ — TRY: 1.35 mg · LEDA: 1.47 mg · GIFT: 1.25 mg
Seed mass max1.94 mg
Seed mass min0.03 mg
Life cycle & reproduction35
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flower colourpurple
Flower conspicuousYes
Flowering endAug
Flowering startJun
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formsubshrub
Life spanperennial
Lifespan categoryModerate
Lifespan years10.5 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Resprout abilityNo
Seed number265
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment28
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 200 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Growth formherb
Growth form USDABunch
Habitat GIFTarctic, forest, mountains, sand, shores, stony places, tundra
Hedge toleranceNone
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · LEDA: semi-woody · GIFT: non-woody
Physiology & chemistry25
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceHigh
Frost free days min110 days
Leaf dry-matter content (LDMC)291 mg/g
⚠ sources differ — TRY: 291 mg/g · LEDA: 174 mg/g
Leaf n17 mg/g
Leaf p2.25 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min4.7 pH
Specific leaf area (SLA)14.26 mm²/mg
⚠ sources differ — TRY: 14.26 mm²/mg · GIFT: 15.54 mm²/mg
Temperature min-28 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits8
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousYes
Fruit seed persistenceNo
Planting density max19 000 per acre
Planting density min10 000 per acre
Seeds per fruit101-1000
03Chemical composition7 compounds
Compounds documented for Armeria maritima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Flavonols4
Cinnamic acids and derivatives1
Fatty acyl carnitines1
Aminoacids1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3-(Methylazaniumyl)propanoate | present | LOTUS | |
| Isorhamnetin | present | LOTUS | |
| Kaempferol | present | LOTUS | |
| Myricetin | present | LOTUS | |
| Quercetin | present | LOTUS | |
| trans-Caffeic acid | present | LOTUS | |
| β-alanine betaine | present | LOTUS |
05DNA & barcoding53 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Armeria maritima has left across the world's sequence archives.
At a glance
DNA specimens53
Marker genes6
GenBank sequences10
eDNA detections32
Countries9
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTTTGCCTGGGCGTCACGCATT …
Armeria maritima voucher CCDB-18332-E10 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL2★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Armeria maritima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 425 450 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Armeria maritima4.43 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records14–362n range18median18mode125records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 18116×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +19
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Kovanda M., 1983: Chromosome numbers in selected Angiosperms (1). - Preslia 55/3: 193-205.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · brit-fl — Baker, H.G. Watsonia 4: 136-139 (1958)
CCDB · brit-fl — Dale, A. Watsonia 13: 49-51 (1980)
CCDB · brit-fl — Hedberg, O. Svensk Bot. Tidskr. 52: 37-46 (1958)
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2101
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2102
CCDB · fl-europaea — Fernandes, 1950
CCDB · fl-europaea — Ltfve & LOve, 1956
CCDB · fl-europaea — Baker, 1959
CCDB · fl-europaea — Griesinger, 1937
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · poland — Kovanda M. 1983. Chromosome numbers in selected Angiosperms (1) Preslia, Praha, 55, 193-205.
CCDB · ipcn-api-dl — Buttler, K. P. 1983. Chromosomenzahlen von Gefässpflanzen aus Hessen (und dem angrenzenden Bayern). 1. Folge. Hess. Florist. Briefe. 32: 23–26ý.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2007. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 2. Kochia 2: 31–35.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Pan, J. s. 2004. Propagation in vitro and karyotype analysis of Armeria maritima. Guihaia 24(1): 33–36.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1980. In Chromosome number reports LXIX. Taxon 29: 705.
CCDB · ipcn-api-dl — Kovanda, M. 1978. Chromosome numbers of miscellaneous United States dicotyledons. Rhodora 80: 431–440.
CCDB · ipcn-api-dl — Dale, A. 1980. The karyotype of Armeria maritima (Mill.) Wilid. Watsonia 13: 49–51.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · ipcn-api-dl — Coulaud, J., N. Barghi, C. Lefèbvre & S. Siljak-yakovlev. 1999. Cytogenetic variation in populations of Armeria maritima (Mill.) Willd. in relation to geographical distribution and soil stress tolerances. Canad. J. Bot. 77: 673–685.
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn72 — ENGELSKJOEN, T., & G. KNABEN. 1971. Chromosome numbers of Scandinavian arctic-alpine plant species. III. Acta Boreal., A, Scientia No. 28: 1-30.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G. 1969. Chromosome number in certain plant species indigenous to the north-east of the USSR. IV. Bot. Zurn. 54: 1985-1990.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.
CCDB · book-ipcn67-71 — DELAY, J . & D. COUSTAUT. 1968. Plumbaginacees I. Inf. Ann. Caryosyst. et Cytogenet. 2: 23-24.
CCDB · book-ipcn67-71 — DELAY, J., & D. COUSTANT. 1969. Plumbaginacees II. Inf. Ann. Caryosyst. et Cytogenet. 3: 5.
CCDB · book-ipcn67-71 — DONADILLE, P. 1967. Etude caryologique du genre Armeria Willd. c. R. Acad. Sc. Paris 264: 813-816.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — SUDA, Y. 1969. Karyotypes of some taxa in Armeria. Sci. Rep. Tohoku Univ. Ser. 4 (Biol.) 35: 21-31.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
+53 more references
2n 146×CCDB · iber-fl · CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · iber-fl — Etudes sur les chromosomes. VI. Sur le nombre des chromosomes de Armeria maritima (Mill.)Willd. Fernandes, A.Bol. Soc. Brot. ser. 26: 305-306(1930).
CCDB · book-fedorov — Fernandes A. 19291930
CCDB · book-fedorov — Tischler 1937
CCDB · book-fedorov — Tischler 1934
CCDB · CromoCat 2015 — Fernandes, A. (1930c). Etudes sur les chromosomes. VI. Sur le nombre des chromosomes de Armeria maritima (Mill.) Willd. Bol. Soc. Brot. 6: 305-306.
CCDB · CromoCat 2015 — Tischler, G. (1937a). Die Bedeutungen der Polyploidie undire Verbreitung der Angiosperm erlauter an den Arten Schleswig-Holsteins mit Ausblicken auf andere Florengebiete. Bot. Jahrb. Syst. 67: 1-36.
2n 202×CCDB · book-fedorov
CCDB · book-fedorov — Sugiura 1936a, b
CCDB · book-fedorov — Rohweder 1937
2n 361×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Sugiura 1939
n 95×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · ita-fl — D'AMATO F. - 1940. Contributo all'embriologia delle Plumbaginaceae.. N. Giorn. Bot. Ital., n.s. , 47(2): 349-382.
CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.
CCDB · book-ipcn67-71 — DELAY, J . & D. COUSTAUT. 1968. Plumbaginacees I. Inf. Ann. Caryosyst. et Cytogenet. 2: 23-24.
CCDB · CromoCat 2015 — Moore, D. M. (1981). Cromosome numbers of Fuegian angiosperms. Boletim da Sociedade Broteriana 53: 995-1012
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1953). Contribuiçao para o conhecimento cariológico das halófilas e psamófitas litorais. Diss. Univ. Coimbra 1-210
n 81×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type126 036 records
Wild obs. + sensor120 992
Museum / vouchered4 891
Cultivated / captive60
Other93
Origin
Native12 048
Introduced166
Range
Area of Occupancy AOO119 092 km²
Depth
0–200 m sunlit1
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 2.5 m · max 2.5 m · 1 record with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 45 919≤1 km 19 664≤10 km 41 047>10 km 585
107 215 georeferenced · 13 777 without coordinates
Open the mapobservation + sensor120 992
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 284≤1 km 877≤10 km 1 588>10 km 123
2 872 georeferenced · 2 019 without coordinates
Open the institutions mapphysical evidence4 891
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 3≤10 km 11>10 km 23
37 georeferenced · 23 without coordinates
Open the mapnot free-living60
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions86 of 163 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 632 |
| LDlocation not on record | 266 |
| Bergen, NO | 170 |
| Brussel, BE | 144 |
| Trondheim, NO | 143 |
| Garðabær, IS | 112 |
| TROMlocation not on record | 111 |
| Oskarshamn, SE | 102 |
| BFLlocation not on record | 98 |
| DBF-NHMDlocation not on record | 79 |
| KMNlocation not on record | 68 |
| MAlocation not on record | 59 |
| Museo Entomologico de Leonlocation not on record | 58 |
| Uniwersytet Warszawskilocation not on record | 57 |
| 51 | |
| South Kensington, GB | 46 |
| Chongqing Museumlocation not on record | 42 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 40 |
| Moscow State Universitylocation not on record | 30 |
| Olocation not on record | 29 |
| SLU Artdatabankenlocation not on record | 27 |
| Görlitz, DE | 27 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 26 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 23 |
| Vitoria, ES | 21 |
| San Isidro, AR | 21 |
| Uppsala, SE | 20 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Saint Louis, US | 15 |
| Tacoma, US | 14 |
| Angwin, US | 13 |
| Córdoba, AR | 13 |
| BDBClocation not on record | 13 |
| Tilburg, NL | 12 |
| Castelar, AR | 12 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 11 |
| Karlsruhe, DE | 11 |
| Hobart, AU | 11 |
| MeiseBGlocation not on record | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Denver, US | 9 |
| Entomological Society of Latvialocation not on record | 9 |
| WTUlocation not on record | 9 |
| Madrid, ES | 9 |
| Berlin, DE | 8 |
| Santa Barbara, US | 8 |
| NMBU:MINAlocation not on record | 7 |
| Edinburgh, GB | 7 |
| Wlocation not on record | 7 |
| GJOlocation not on record | 7 |
| Barcelona, ES | 7 |
| València, ES | 7 |
| Riverside, US | 7 |
| Valparaiso, CL | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| Whitehorse, CA | 6 |
| Stockholm, SE | 6 |
| Auckland, NZ | 6 |
| Bern, CH | 6 |
| BClocation not on record | 6 |
| Provincia di Livornolocation not on record | 5 |
| Helsinki, FI | 5 |
| Pullman, US | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Vancouver, CA | 4 |
| Christchurch, NZ | 4 |
| Alicante, ES | 4 |
| BSBIlocation not on record | 4 |
| Pamplona, ES | 4 |
| Wellington, NZ | 4 |
| Kew, GB | 4 |
| Salamanca, ES | 4 |
| Rovaniemi, FI | 4 |
| Bourges, FR | 4 |
| Tromso University Museumlocation not on record | 3 |
| Turlock, US | 3 |
| Anchorage, US | 3 |
| nbflocation not on record | 3 |
| Kuopio, FI | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Jyväskylä, FI | 3 |
| National Museum Waleslocation not on record | 3 |
| Flagstaff, US | 3 |
| Göteborg, SE | 3 |
| Podgorica, ME | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Logan, US | 3 |
| UoB-IBlocation not on record | 3 |
| Coimbra, PT | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Jaén, ES | 2 |
| Taipei, TW | 2 |
| Fullerton, US | 2 |
| San Luis Obispo, US | 2 |
| Paris, FR | 2 |
| Badajoz, ES | 2 |
| Victoria, CA | 2 |
| UChlocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Dresden, DE | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| GINRlocation not on record | 2 |
| Dekalb, US | 2 |
| Canadian Museum of Naturelocation not on record | 2 |
| PTHlocation not on record | 2 |
| Irkutsk State Universitylocation not on record | 2 |
| Memorial University of Newfoundlandlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Toronto, CA | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| Granada, ES | 2 |
| Université Lavallocation not on record | 1 |
| WINlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| BRNUlocation not on record | 1 |
| Tallinn, EE | 1 |
| Xiamen, CN | 1 |
| Bend, US | 1 |
| Citadel Hill, GB | 1 |
| Saint John, CA | 1 |
| Philadelphia, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| St. Paul, US | 1 |
| PRClocation not on record | 1 |
| Bangkok, TH | 1 |
| DASSHlocation not on record | 1 |
| Porrentruy, CH | 1 |
| San Angelo, US | 1 |
| Bloomington, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Wuzhou, CN | 1 |
| QVMAGlocation not on record | 1 |
| JP | 1 |
| Boumlocation not on record | 1 |
| Moscow, US | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| University of Montpellierlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Banyoles, ES | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| US | 1 |
| FLADlocation not on record | 1 |
| University of Hulllocation not on record | 1 |
| Elocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Long Beach, US | 1 |
| Columbia, US | 1 |
| Forssa, FI | 1 |
| Oulu, FI | 1 |
| McWane Science Centerlocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| ASUlocation not on record | 1 |
| ER Hellerlocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Bronx, US | 1 |
| Valparaíso, CL | 1 |
| Taipei, TW | 1 |
163 institutions · 4 015 of 4 891 vouchered records shown · 612 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA32 detections
Where the DNA of Armeria maritima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found32
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 32 detections have coordinates
Open the map9 countries0
Open platey freshwater beach sandFlat Sedge -Dwarf Shrub with boiling structu…Trinity College Botanical Gardens, Growing i…inactive younger sand-gravel river terraceSlope of small escarpment; dry, willow-herb …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.0 °C 7.00–15.7
Seasonal swing summer↔winter15.1 °C
Max temp (day)16.2 °C 9.40–20.1
Min temp (night)9.00 °C 3.60–13.4
Precipitation69.6 mm/mo 33.4–83.6
Air humidity62.0 % 52.9–65.4
Moisture balance-30.8 mm/mo
Vapour deficit593 Pa 367–953
Wind speed4.40 m/s
Cloud cover48.2 % 38.3–73.1
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.