Arjona patagonica

Hombr. & Jacquinot ex Decne. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Schoepfiaceae/Arjona

At a glance

Occurrence records140

Data sources8

Biological traits11

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Arjona patagonica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Arjona patagonica is a species of flowering plant in the family Schoepfiaceae native to southern South America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arjona patagonica has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections7

The DNA barcodea real sequence read deposited for this species

ITSMH660600.1 ↗578 bp

ACGT

GACCTGTGCACGTGTTAAAAATTTGGGGAGTTAGGGTCCTCGGATCCTCTCTCCCCGCAGCTCGAGCGGCCATCATCTGCATGGCCGTCT …

Arjona patagonica voucher CONC Pisano 3594 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arjona patagonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.

08Occurrence & distribution

Record type140 records

Wild obs. + sensor98

Museum / vouchered42

Origin

Native3

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 44≤1 km 10≤10 km 3>10 km 3

60 georeferenced · 38 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	10
San Isidro, AR	9
Valparaiso, CL	6
Kew, GB	3
Corrientes, AR	3
Buenos Aires, AR	2
Berlin, DE	2
Laboratory of Palaeontologylocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
Stockholm, SE	1
Chicago, US	1
Edinburgh, GB	1
Saint Louis, US	1
Christchurch, NZ	1

14 institutions · 42 of 42 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Arjona patagonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)