Aristotelia chilensis

(Molina) Stuntz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Elaeocarpaceae/Aristotelia

At a glance

Occurrence records2 020

Data sources13

Biological traits26

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Aristotelia chilensis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 020 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS · NPASS22 compounds

Occurrence & distributionGBIF2 020 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI≈354 Mbp

01Narrative

Aristotelia chilensis, known as maqui or Chilean wineberry, is a tree species in the Elaeocarpaceae family native to South America in the Valdivian temperate rainforests of Chile and adjacent regions of southern Argentina. Limited numbers of these trees are cultivated in gardens for their small fruits, known as maqui berries. Most of the fruits commercially marketed come from the wild.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology8

Plant height0.357 m

Seed length2 mm

Seed mass41.61 mg

⚠ sources differ — TRY: 41.61 mg · GIFT: 45.93 mg

Seed mass max76.6 mg

Seed mass min15.26 mg

Seed volume48 mm³

Seed volume max48 mm³

Seed volume min48 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

⚠ sources differ — GIFT: tree · TRY: S

Mycorrhiza type0.00000593

Woodinesswoody

Physiology & chemistry3

Leaf n17.25 mg/g

Leaf p1.85 mg/g

Specific leaf area (SLA)28.55 mm²/mg

03Chemical composition22 compounds

Compounds documented for Aristotelia chilensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Carboline alkaloids4

Oleanane triterpenoids2

Simple coumarins1

Anthocyanidins1

Carbazole alkaloids1

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,10R,12R,15S,17S,19R)-1,14,14-trimethyl-3,13-diazapentacyclo[13.2.2.02,10.04,9.012,17]nonadeca-2,4,6,8-tetraene-10,19-diol	present	LOTUS
(1R,12R,15S,17S)-1,14,14-trimethyl-3,13-diazapentacyclo[13.2.2.02,10.04,9.012,17]nonadeca-2(10),4,6,8-tetraene	present	LOTUS
(1R,12S,15S,17S)-1,14,14-trimethyl-3,13-diazapentacyclo[13.2.2.02,10.04,9.012,17]nonadeca-2(10),4,6,8-tetraen-11-one	present	LOTUS
(1R,15S,17S)-1,14,14-trimethyl-3,13-diazapentacyclo[13.2.2.02,10.04,9.012,17]nonadeca-2(10),4,6,8,12-pentaen-11-one	present	LOTUS
(1S,2R,4R,12S,15S,18R)-14,14,18-trimethyl-5,13-diazahexacyclo[13.3.1.02,13.04,12.04,18.06,11]nonadeca-6,8,10-trien-16-one	present	LOTUS
1,14,14-Trimethyl-3,13-diazapentacyclo[13.2.2.02,10.04,9.012,17]nonadeca-2,4,6,8-tetraen-10-ol	present	LOTUS
14,14,18-Trimethyl-5,13-diazahexacyclo[13.3.1.02,13.04,12.04,18.06,11]nonadeca-6,8,10-trien-16-one	present	LOTUS
[(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-yl] (E)-3-(4-hydroxyphenyl)prop-2-enoate	present	NPASS
[(1S,5S)-4,4-dimethyl-8-methylidene-3-azabicyclo[3.3.1]non-2-en-2-yl]-(1H-indol-3-yl)methanone	present	LOTUS
[(3S)-2,3-dihydro-1H-indol-3-yl]-[(1R,5R)-4,4,8-trimethyl-3-azabicyclo[3.3.1]nona-2,7-dien-2-yl]methanone	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristotelia chilensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSDQ448660.1 ↗596 bp

ACGT

TGTCGAAACCTGCCTAGCAGAACGACCCGCGAACAAGTTCAACCAAAACGATTTGGCCGGGGGAAGCACGGGTTCTGCCTCGGCAGGTCC …

Aristotelia chilensis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Aristotelia chilensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈354 125 139 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aristotelia chilensis0.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · Cave1963

CCDB · Cave1963 — Tschischow 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 020 records

Wild obs. + sensor1 776

Museum / vouchered236

Cultivated / captive8

Origin

Native36

Introduced9

Range

Area of Occupancy AOO4 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 053≤1 km 174≤10 km 52>10 km 26

1 305 georeferenced · 471 without coordinates

Open the mapobservation + sensor1 776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 3≤1 km 11≤10 km 8>10 km 4

26 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence236

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 4 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	30
Valparaiso, CL	24
Castelar, AR	21
UChlocation not on record	17
Saint Louis, US	17
MAlocation not on record	12
ASUlocation not on record	8
Nunoa, Santiago, CL	8
Auckland, NZ	7
Christchurch, NZ	6
Edinburgh, GB	6
Mount Annan, AU	5
San Isidro, AR	5
San Jose State University, Museum of Birds and Mammalslocation not on record	5
Córdoba, AR	4
Rotorua, NZ	4
Riverside, US	4
Museo Entomologico de Leonlocation not on record	4
Corrientes, AR	3
Berlin, DE	3
MeiseBGlocation not on record	3
Canadian Department of Agriculturelocation not on record	3
Stockholm, SE	2
San Diego, US	2
University of Stellenboschlocation not on record	2
The University of Arizonalocation not on record	2
Bronx, US	2
Herbario Universidad de Concepciónlocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
Wlocation not on record	1
Hobart, AU	1
Tampa, US	1
Görlitz, DE	1
CJBGlocation not on record	1
Universidad Nacional de La Patagonialocation not on record	1
Universidad Nacional de Misiones- CONICETlocation not on record	1
Valparaíso, CL	1
Kew, GB	1
Uppsala, SE	1
Bangkok, TH	1
València, ES	1
Barcelona, ES	1
Bloomington, US	1
Helsinki, FI	1
Boise, US	1
South Kensington, GB	1

46 institutions · 230 of 236 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Aristotelia chilensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aristotelia chilensis

At a glance

Sources13 archives

Size & morphology8

Life cycle & reproduction4

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Compound class profile5 classes

Documented compounds22 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 020 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions31 of 46 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 020 records