Aristolochia tuberosa

C.F.Liang & S.M.Hwang · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records33

Data sources8

Biological traits8

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Aristolochia tuberosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF33 records

DNA & barcodingNCBIsequences

01Narrative

Aristolochia tuberosa is a species of plant in the family Aristolochiaceae. It is endemic to China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology3

Fruit length30 mm

Fruit length max30 mm

Fruit length min30 mm

Habitat & environment5

Climatetemperate

Elevation max1 600 m

Elevation mean875 m

Elevation min150 m

Woodinessnon-woody

03Chemical composition12 compounds

Compounds documented for Aristolochia tuberosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aporphine alkaloids6

Phenanthrenes2

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
10-[3,4,5-Trihydroxy-6-(hydroxymethyl)oxan-2-yl]-3,5-dioxa-10-azapentacyclo[9.7.1.02,6.08,19.013,18]nonadeca-1(19),2(6),7,11,13,15,17-heptaen-9-one	present	LOTUS
16-hydroxy-10-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-3,5-dioxa-10-azapentacyclo[9.7.1.02,6.08,19.013,18]nonadeca-1(18),2(6),7,11(19),12,14,16-heptaen-9-one	present	NPASS
17-hydroxy-11-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(19),2(6),7,12(20),13,15,17-heptaene-9,10-dione	present	LOTUS
17-Hydroxy-11-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(19),2(6),7,12(20),13,15,17-heptaene-9,10-dione	present	LOTUS
17-Hydroxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(19),2(6),7,12(20),13,15,17-heptaene-9,10-dione	present	LOTUS
7-Hydroxy-14-methoxy-3,5-dioxa-10-azapentacyclo[9.7.1.02,6.08,19.013,18]nonadeca-1(18),2(6),7,11(19),12,14,16-heptaen-9-one	present	LOTUS
Aristolochic Acid	present	LOTUS
Aristolochic Acid Ii	present	LOTUS
Aristololactam IIIa	present	NPASS
Aristoloside	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia tuberosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

The DNA barcodea real sequence read deposited for this species

ITSKM092174.1 ↗256 bp

ACGT

CGCCCGACGCCTTCTCACCTCCCCGTCACGCGCTGCCGCGCGTCGCCGGGGAGGGCGAGCAGTTGGCCGTCCCTGCCCCCGCGGTGAGGT …

Aristolochia tuberosa voucher YC0681MT02 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor2

Museum / vouchered31

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 31 records without

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ischia Marine Centrelocation not on record	8
Guiyang, CN	8
Guilin, CN	6
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	3
Kunming, CN	2
Chengdu, CN	1
Beijing, CN	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
Guangzhou, CN	1

9 institutions · 31 of 31 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)