Aristolochia sempervirens

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records985

Data sources10

Biological traits13

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Aristolochia sempervirens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility985 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF985 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

L'aristoloche élevée ou aristoloche toujours verte est une espèce de plantes à fleurs de la famille des Aristolochiaceae. C'est une plante grimpante fréquente dans les régions de la Méditerranée orientale. Elle n'est présente en France que dans les deux départements du Var et des Alpes-Maritimes. On la trouve dans les lieux ombragés comme les haies ou les lisières de bois. Ses feuilles sont persistantes et ses fleurs présentent la forme d'un tube recourbé jaune avec des rayures marron.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height3.25 m

Seed mass27.29 mg

Life cycle & reproduction4

DeciduousnessEvergreen broad-leaved

Life formclimbing shrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Growth formclimber

Woodinessnon-woody

Physiology & chemistry1

Wood density290 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia sempervirens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKAB211560.1 ↗1 200 bp

ACGT

ATGTACTTGCTCATAATCATGATTTAAAAGGATCGATTGTTTACGAATCGATGGAAAATTTAGGTTATGACAAAAAATTAAGTTCACTAA …

Aristolochia sempervirens chloroplast matK gene for maturase, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aristolochia sempervirens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1993. Mediterranean chromosome number reports 3 (171--176). Fl. Medit. 3: 338–340.

n 71×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Montmollin, B. d. 1986. étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type985 records

Wild obs. + sensor830

Museum / vouchered153

Cultivated / captive1

Other1

Origin

Introduced58

Range

Area of Occupancy AOO1 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 175≤1 km 95≤10 km 31>10 km 3

304 georeferenced · 526 without coordinates

Open the mapobservation + sensor830

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 3

14 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence153

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dresden, DE	78
LDlocation not on record	22
BDBClocation not on record	8
BIO-UNIPIlocation not on record	8
Berlin, DE	5
Wlocation not on record	5
BClocation not on record	4
BRNUlocation not on record	3
Provincia di Livornolocation not on record	2
València, ES	2
MAlocation not on record	1
Porrentruy, CH	1
Barcelona, ES	1
Saint Louis, US	1
Frankfurt am Main	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Rotorua, NZ	1
Tilburg, NL	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

19 institutions · 146 of 153 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Aristolochia sempervirens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)