Aristolochia rotunda

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records11 753

Data sources12

Biological traits21

DNA specimens5

eDNA detections2

Sources12 archives

Databases and archives Aristolochia rotunda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 753 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF11 753 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB290 Mbp

01Narrative

L'aristoloche à feuilles rondes est une espèce de plantes à fleurs de la famille des Aristolochiaceae. C'est une plante herbacée commune dans les pays méditerranéens, notamment autour de la Camargue en France

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Plant height0.4 m

Plant height generative0.408 m

Seed mass46.9 mg

Life cycle & reproduction5

DeciduousnessEvergreen broad-leaved

Life formtuberous geophyte

Life spanperennial

Lifespan years3 years

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: vine

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio13.07 g/g

Leaf c433 mg/g

Leaf dry-matter content (LDMC)274 mg/g

Leaf n33.59 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)20.5 mm²/mg

03Chemical composition7 compounds

Compounds documented for Aristolochia rotunda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Aporphine alkaloids8

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Stigmastane steroids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,8R,9R,10S,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
Aristolactam	present	LOTUS
Aristolochic Acid	present	LOTUS
Aristolochic acid I methyl ester	present	NPASS
Aristolochic Acid Ii	present	LOTUS
Hayatine	present	LOTUS
Methyl 6-nitronaphtho[2,1-g][1,3]benzodioxole-5-carboxylate	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia rotunda has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKDQ296665.1 ↗2 602 bp

ACGT

TGATCTTTTACACATTTGGATGAAGCAACGAATTCGTCCATACCATTGGTAGAGTTTGTAAGACCACGACTGATCCAGAAGGGGAATGAA …

Aristolochia rotunda trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aristolochia rotunda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size290 406 122 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aristolochia rotunda0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–142n range12median12mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1217×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

CCDB · ita-fl — NARDI E. - 1984. The genus "Aristolochia" L. (Aristolochiaceae) in Italy.. Webbia , 38: 221-300.

CCDB · ita-fl — FABBRI F., FAGIOLI A. - 1971. Numeri cromosomici per la flora italiana:19-22.. Inform. Bot. Ital. , 3(1): 51-55.

CCDB · ipcn-api-dl — Nardi, E. 1984. The genus Aristolochia L. (Aristolochiaceae) in Italy. Webbia 38: 221–300.

CCDB · ipcn-api-dl — Aboucaya, A. & R. Verlaque. 1990. IOPB chromosome data 2. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 15: 10–11.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · book-ipcn67-71 — FABRI, F., & A. FAGIOLI. 1971. In Numeri cromosomici per la flora Italiana. Inf. Bot. Italiano 3: 47-94.

CCDB · CromoCat 2015 — Aboucaya, A. & Verlaque, R. (1990). IOPB Chromosome Data 2 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 15: 10-11.

CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.

CCDB · CromoCat 2015 — Constantinidis, T. & Kamari, G. (1994). Reports (377-386). Fl. Medit. 4: 290-295.

2n 144×CCDB · nw-europe-fl · CCDB · book-fedorov · CCDB · Cave1956 +1

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1590

CCDB · book-fedorov — Gregory M. P. 1956

CCDB · Cave1956 — Gregory

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

n 62×CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · ipcn-api-dl — Aboucaya, A. & R. Verlaque. 1990. IOPB chromosome data 2. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 15: 10–11.

CCDB · CromoCat 2015 — Aboucaya, A. & Verlaque, R. (1990). IOPB Chromosome Data 2 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 15: 10-11.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 753 records

Wild obs. + sensor11 206

Museum / vouchered508

Other39

Origin

Introduced6

Range

Area of Occupancy AOO13 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 3 663≤1 km 995≤10 km 4 256>10 km 280

9 194 georeferenced · 2 012 without coordinates

Open the mapobservation + sensor11 206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 15≤1 km 28≤10 km 101>10 km 2

146 georeferenced · 362 without coordinates

Open the institutions mapphysical evidence508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	107
BDBClocation not on record	61
Dresden, DE	59
LDlocation not on record	54
BClocation not on record	36
Bern, CH	30
Barcelona, ES	24
Institut und Museum fuer Geologie und Palaeontologielocation not on record	17
South Kensington, GB	11
Wlocation not on record	7
Oskarshamn, SE	6
BRNUlocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
UIBlocation not on record	5
MAlocation not on record	5
BIO-UNIPIlocation not on record	4
Xiamen, CN	4
CJBGlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	3
GJOlocation not on record	3
Sevilla, ES	3
Tilburg, NL	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Salamanca, ES	2
GZUlocation not on record	2
John May Museum of Natural Historylocation not on record	2
Bourges, FR	2
Porrentruy, CH	2
Karlsruhe, DE	2
New Haven, US	1
Montréal, CA	1
Saint Louis, US	1
SNSNMClocation not on record	1
Philadelphia, US	1
Görlitz, DE	1
Banyoles, ES	1
San Sebastián, ES	1
Macomb, US	1
Muséum Henri Lecoqlocation not on record	1
Uppsala, SE	1
València, ES	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Paris, FR	1
CASlocation not on record	1

45 institutions · 485 of 508 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Aristolochia rotunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aristolochia rotunda

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Physiology & chemistry6

Compound class profile3 classes

Documented compounds7 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type11 753 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type11 753 records