Aristolochia praevenosa

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records666

Data sources7

Biological traits30

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Aristolochia praevenosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility666 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF666 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Pararistolochia praevenosa is an Australian vine in the birthwort family. The Richmond birdwing butterfly vine grows in subtropical rainforest in coastal areas north from Wollongbar, in far north eastern New South Wales and adjacent areas in south eastern Queensland. It has been recorded as far north as the Mary River. It also grows in tropical north eastern Queensland, where it is a food plant for the Cairns birdwing butterfly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length19 mm

Fruit width19 mm

Leaf length70 mm

Leaf length max250 mm

Leaf length min70 mm

Leaf size5 880 mm²

Leaf width25 mm

Leaf width max80 mm

Leaf width min25 mm

Petiole length2 cm

Seed length4 mm

Seed width4.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typewind

Flowering timennnnnnnnnyyn

Life formliana

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeutricle

⚠ sources differ — AusTraits: utricle · GIFT: capsule

Growth formclimber

Leaf compoundnesssimple

Leaf shapeelliptical oblong obovate ovate

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia praevenosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ667462.1 ↗514 bpAustralia

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATCAAACCAAAGATACTGATATCTTGGCAGCA …

Pararistolochia praevenosa voucher JCU_IG07 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type666 records

Wild obs. + sensor462

Museum / vouchered151

Other53

Origin

Native12

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 248≤1 km 47≤10 km 4>10 km 18

317 georeferenced · 145 without coordinates

Open the mapobservation + sensor462

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 90≤1 km 11≤10 km 26>10 km 4

131 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	106
Smithfield, AU	18
Mount Annan, AU	11
Museo Entomologico de Leonlocation not on record	4
Canberra, AU	4
Kew, GB	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Armidale, AU	2
Cambridge, US	1
Honolulu, US	1

10 institutions · 151 of 151 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aristolochia praevenosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 19.7–19.7

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.4 °C

Min temp (night)15.6 °C

Precipitation89.6 mm/mo

Air humidity58.8 %

Moisture balance-29.8 mm/mo

Vapour deficit958 Pa

Wind speed2.60 m/s

Cloud cover24.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)