Aristolochia paucinervis

Pomel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records8 321

Data sources12

Biological traits26

DNA specimens4

eDNA detections2

Sources12 archives

Databases and archives Aristolochia paucinervis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 321 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS17 compounds

Occurrence & distributionGBIF8 321 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Aristolochia paucinervis is a herbaceous plant in the family Aristolochiaceae endemic to the western Mediterranean Basin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length max2.5 mm

Fruit length min1 mm

Leaf length max8.5 mm

Leaf length min3 mm

Leaf width max6 mm

Leaf width min2 mm

Plant height0.55 m

Plant height max0.9 m

Plant height min0.2 m

Life cycle & reproduction9

DeciduousnessEvergreen broad-leaved

Dehiscencedehiscent

Flower length max6 mm

Flower length min3 mm

Flowering endJun

Flowering startFeb

Life formtuberous geophyte

Life spanHerbaceous perennial

⚠ sources differ — TRY: Herbaceous perennial · GIFT: perennial

Raunkiær life formcryptophyte

Habitat & environment8

Climatesubtropical

Elevation max100 m

Elevation min0 m

Fruit colourbrown

Fruit typecapsule

Growth formGeophyte

Leaf formovate

Woodinessnon-woody

03Chemical composition17 compounds

Compounds documented for Aristolochia paucinervis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Wax monoesters10

Pinane monoterpenoids2

Aporphine alkaloids2

Phytane diterpenoids $ Wax monoesters1

Stigmastane steroids1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(2E,7R,11R)-3,7,11,15-tetramethyl-2-hexadecen-1-yl hexadecanoate	present	LOTUS
9-Octadecenoic acid (9Z)-, 2-methylpropyl ester	present	LOTUS
[(1R,5R,6R)-2,6-dimethyl-6-bicyclo[3.1.1]hept-2-enyl]methyl acetate	present	LOTUS
[(1S,5S,6R)-2,6-dimethyl-6-bicyclo[3.1.1]hept-2-enyl]methanol	present	LOTUS
[(E,7R,11R)-3,7,11,15-tetramethylhexadec-2-enyl] (9Z,12Z)-octadeca-9,12-dienoate	present	LOTUS
Aristolochic Acid	present	LOTUS
Aristolochic Acid Ii	present	LOTUS
beta-Sitosterol	present	LOTUS
Ethyl alpha-linolenate	present	LOTUS
Ethyl hexadecanoate	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia paucinervis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ137953.1 ↗254 bpPortugal · 2019

ACGT

GCGAACCATCGAGTCTTTGAAAGTAAGTTGCACCCGAGGCCACTAGGTCGAGGGCACACCTGCCTGGGCGTCACGCCCGACGCTTTCTAC …

Aristolochia paucinervis voucher PLT.0286 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★trnL-F★ITS1★ITS2cp-trnL-intron

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Aristolochia paucinervis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidypolyploid inferred

Chromosome records12–362n range26median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

2n 241×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

2n 281×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Valdés, B., S. Talavera & E. Fernández Galiano. (eds.) (1987). Flora Vascular de Andalucía Occidental. Barcelona

2n 361×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Tutin et al. (1874). Nov. Matér. Fl. AH.: 137 Flora Europaea 1

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 321 records

Wild obs. + sensor7 294

Museum / vouchered1 027

Origin

Native666

Range

Area of Occupancy AOO16 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 2 406≤1 km 1 230≤10 km 1 761>10 km 118

5 515 georeferenced · 1 779 without coordinates

Open the mapobservation + sensor7 294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 31≤1 km 373≤10 km 109

513 georeferenced · 514 without coordinates

Open the institutions mapphysical evidence1 027

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	176
CICYTEXlocation not on record	156
ISAlocation not on record	104
València, ES	92
Badajoz, ES	70
Jaén, ES	61
Salamanca, ES	39
College of the Atlantic, Museumlocation not on record	37
Madrid, ES	35
Vitoria, ES	31
Granada, ES	25
BClocation not on record	22
Córdoba, ES	21
Entomological Society of Latvialocation not on record	20
San Sebastián, ES	15
Wlocation not on record	12
Sevilla, ES	11
Universidad del Pais Vasco (UPV/EHU)location not on record	10
Museo Achille Folettolocation not on record	9
Alicante, ES	8
Phyletisches Museum Jenalocation not on record	7
Coimbra, PT	6
Museo della Bonifica di San Donà di Piavelocation not on record	6
South Kensington, GB	6
JBSlocation not on record	6
Dresden, DE	5
UIBlocation not on record	4
LDlocation not on record	4
Berlin, DE	3
Pamplona, ES	3
Pamplona, ES	2
OLAlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Xiamen, CN	1
Bourges, FR	1
University of Stellenboschlocation not on record	1
Frankfurt am Main	1
Hunan Geological Museumlocation not on record	1
Paris, FR	1
BRNUlocation not on record	1
Saint Louis, US	1
Madrid, ES	1
Research Center in Biodiversity and Genetic Resourceslocation not on record	1
CIBIOlocation not on record	1
Moscow State Universitylocation not on record	1
Edinburgh, GB	1

46 institutions · 1 023 of 1 027 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Aristolochia paucinervis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 20.2–20.2

Seasonal swing summer↔winter16.9 °C

Max temp (day)25.9 °C

Min temp (night)13.5 °C

Precipitation31.8 mm/mo

Air humidity52.8 %

Moisture balance-133 mm/mo

Vapour deficit1,120 Pa

Wind speed2.70 m/s

Cloud cover35.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aristolochia paucinervis

At a glance

Sources12 archives

Size & morphology9

Life cycle & reproduction9

Habitat & environment8

Compound class profile5 classes

Documented compounds17 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 321 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 321 records