Aristolochia macrocarpa

Duch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records29

Data sources7

Biological traits9

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Aristolochia macrocarpa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Pararistolochia macrocarpa is a rare species of flowering plant in the Aristolochiaceae found in Guinea and Ghana

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max30.48 m

Life cycle & reproduction3

Life formclimber

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment5

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

03Chemical composition6 compounds

Compounds documented for Aristolochia macrocarpa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Furofuranoid lignans3

Aporphine alkaloids2

Naphthalenones1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,4S)-3,4-Dihydro-4-hydroxy-6-methoxy-2,7-dimethyl-1(2H)-naphthalenone	present	LOTUS
(3R,3aS,6R,6aS)-3,6-bis(3,4-dimethoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan	present	LOTUS
Aristolactam	present	LOTUS
Goniopedaline	present	LOTUS
Sesamin, (-)-	present	LOTUS
Sylvatesmin	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia macrocarpa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN366669.1 ↗528 bp

ACGT

GTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCG …

Pararistolochia macrocarpa voucher IDRCG765-13_FHO_PS2198 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor13

Museum / vouchered16

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 3≤1 km 2≤10 km 1>10 km 5

11 georeferenced · 2 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	4
Xining, CN	3
South Kensington, GB	2
Kew, GB	1
Nanjing, CN	1
Beijing, CN	1
nlocation not on record	1

7 institutions · 13 of 16 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Aristolochia macrocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter2.90 °C

Max temp (day)28.4 °C

Min temp (night)20.6 °C

Precipitation85.9 mm/mo

Air humidity67.9 %

Moisture balance-30.3 mm/mo

Vapour deficit962 Pa

Wind speed0.9 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)