Aristolochia indica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records167

Data sources13

Biological traits22

DNA specimens7

eDNA detections6

Sources13 archives

Databases and archives Aristolochia indica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Chemical compositionLOTUS · NPASS43 compounds

Occurrence & distributionGBIF167 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Aristolochis Plant Aristolochia indica (native language: Garudakkodi / Eswaramooli) is a creeper plant found in Southern India and also Sri Lanka.It Is known as 'Sapsada' in Sri Lanka .This plant is critical to the survival of the southern birdwing and common birdwing,Introduction to the Aristolochiales as well as crimson and common rose butterflies. It reaches a height of several metres on trees and cover the branches with thick foliage. It is commonly found in forest floor, rocky hillslopes. It flowers once a year to produce seeds. It can also be propagated by roots. The plant has a number of historical medicinal uses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length30 mm

Fruit width16.5 mm

Leaf length85 mm

Leaf width42.5 mm

Petiole length2.35 cm

Seed length7 mm

Seed width3 mm

Life cycle & reproduction4

Life formclimber

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Climber

Leaf compoundnesssimple

Leaf shapeoblong obovate

Woodinessvariable

⚠ sources differ — TRY: variable · AusTraits: herbaceous · GIFT: variable

03Chemical composition43 compounds

Compounds documented for Aristolochia indica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids7

Phenanthrenes5

Ishwarane sesquiterpenoids5

Dibenzylbutyrolactone lignans4

Stigmastane steroids3

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ledol	present	LOTUS
(+)-Magnoflorine	present	LOTUS
(-)-Savinin	present	LOTUS
(1R,5R,6S,8S,9R,10R)-5,6,9-trimethyltetracyclo[7.2.1.01,6.08,10]dodecane	present	LOTUS
(1R,5R,6S,8S,9S,10R)-5,6,9-trimethyltetracyclo[7.2.1.01,6.08,10]dodecane	present	LOTUS
(1R,5R,6S,9S,10S)-5,6,10-trimethyltricyclo[7.2.1.01,6]dodecan-10-ol	present	LOTUS
(1S,2S,5R,6S,8S,9S,10R)-5,6,9-trimethyltetracyclo[7.2.1.01,6.08,10]dodecan-2-ol	present	LOTUS
(3S,8S,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-3-hydroxy-1,2,3,4,8,9,10,11,12,13,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-7-one	present	LOTUS
(3S,8S,9S,10R,13R,14S,17R)-17-[(1R,4R)-4-hydroxy-4-isopropyl-1-methyl-hex-5-enyl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(4R)-4-(1,3-benzodioxol-5-ylmethyl)-3-(1,3-benzodioxol-5-ylmethylidene)oxolan-2-one	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia indica has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences9

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP763863.1 ↗364 bp

ACGT

AACGCAAGTTGCACCCGAGGCCATTAGGCCGAGGGTACACCTGCCTGGGCGTCACGCCCGACGCGCTCTCCCCCCGCCCCGCGCCGCCGC …

Aristolochia indica isolate AI2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aristolochia indica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

CCDB · book-indian_vol1 — Venugopalan, S. 1949; Sharma, A.K. & Varma, B. 1959a, b ; Sanjappa, M. 1978

CCDB · book-fedorov — Sharma A. K., Varma 1959

CCDB · book-atlas-flowering-plants

CCDB · Cave1959 — Sharma & Varma 1959

n 61×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanjappa, M., A. Dasgupta & R. P. Bhatt. 1978. A note on the cytology of Hibiscus punctatus Dalz. (Malvaceae). Curr. Sci. 47: 549–550.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type167 records

Wild obs. + sensor116

Museum / vouchered50

Cultivated / captive1

Origin

Native2

Introduced10

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 28≤1 km 25≤10 km 9>10 km 12

74 georeferenced · 42 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 11≤1 km 9≤10 km 11

31 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence50

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	12
Smithfield, AU	7
Museo Entomologico de Leonlocation not on record	6
Pondicherry, IN	6
Baroda, IN	4
Brisbane, AU	4
University of Stellenboschlocation not on record	2
Kew, GB	1
Kensington, AU	1
Stockholm, SE	1
Mount Annan, AU	1
Pomona Collegelocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Canberra, AU	1

14 institutions · 48 of 50 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Aristolochia indica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.7 °C 28.7–28.7

Seasonal swing summer↔winter11.9 °C

Max temp (day)31.9 °C

Min temp (night)24.8 °C

Precipitation187 mm/mo

Air humidity62.4 %

Moisture balance33.3 mm/mo

Vapour deficit1,478 Pa

Wind speed2.80 m/s

Cloud cover9.20 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)