Aristolochia fimbriata

Cham. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records500

Data sources12

Biological traits12

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Aristolochia fimbriata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility500 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF500 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI489 Mbp

01Narrative

Aristolochia fimbriata is a species of perennial plant in the family Aristolochiaceae. It is found in Brazil, Paraguay, Bolivia, Uruguay, and Argentina. The flowering plant attracts butterflies and is known for its traditional medicinal properties.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Habitat GIFTÁrea Antrópica, Campo Limpo

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Aristolochia fimbriata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aporphine alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Aristolochic Acid		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia fimbriata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM092122.1 ↗266 bp

ACGT

CGCCCGACGTGTTCTCCCCCCACCCCGTGCCCTGCTGCCCCACCGCGGGCGGTGCGGCGGGTCGTCGGGGGCGAGCAGATTGGTCGTCCT …

Aristolochia fimbriata voucher YC0673MT01 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Aristolochia fimbriata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size489 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aristolochia fimbriata0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · CCDB · Cave1956

CCDB · book-fedorov — Tiickholm, Soderberg 1918

CCDB · book-fedorov — Gregory M. P. 1956

CCDB · book-atlas-flowering-plants — Tiickholm & S. 1918 HM

CCDB · Cave1956 — Gregory

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type500 records

Wild obs. + sensor361

Museum / vouchered136

Cultivated / captive3

Origin

Native16

Introduced61

Range

Area of Occupancy AOO1 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 151≤1 km 104≤10 km 14>10 km 14

283 georeferenced · 78 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence136

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Isidro, AR	31
Porto Alegre, BR	12
University of Stellenboschlocation not on record	11
Corrientes, AR	7
Bronx, US	6
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Saint Louis, US	5
Universidade Federale do Rio Grande do Sullocation not on record	4
Campo Grande, BR	4
INTAlocation not on record	3
Kew, GB	3
UFMSlocation not on record	3
Minia, EG	2
Lake Charles, US	2
BISHlocation not on record	2
Honolulu, US	2
ASUlocation not on record	2
Jena Microbial Resource Collectionlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Burlington, US	1
Istituto Agrario Castelnuovolocation not on record	1
Altos de Pipe, VE	1
Tampa, US	1
Davis, US	1
Laboratorio de Ictiologialocation not on record	1
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
Castelar, AR	1
Phoenix, US	1
Departamento de Geologia, Universidad de Chilelocation not on record	1
GB	1
Santa Cruz de la Sierra, BO	1
Durango, MX	1
La Paz, BO	1
MCNAMlocation not on record	1
South Kensington, GB	1
PUC-RSlocation not on record	1
UNESClocation not on record	1
València, ES	1
CJBGlocation not on record	1
Universidade de São Paulolocation not on record	1
MAlocation not on record	1
IAPlocation not on record	1
Universidade de Passo Fundolocation not on record	1

44 institutions · 134 of 136 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Aristolochia fimbriata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)