Aristolochia eriantha

Mart. & Zucc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records29

Data sources7

Biological traits8

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Aristolochia eriantha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Aristolochia eriantha is a species of perennial plant in the family Aristolochiaceae. It is found in Bolivia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyte detailedterrestrial

Growth formclimber

Habitat GIFTCaatinga (stricto sensu), Cerrado (lato sensu)

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia eriantha has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

rbcLAB205590.1 ↗1 417 bp

ACGT

GTTGGATTCCAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTC …

Aristolochia eriantha chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1

plant barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor5

Museum / vouchered24

Origin

Native14

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	5
Bronx, US	4
Salvador, BR	4
CEPLAClocation not on record	2
UFBAlocation not on record	1
Teresina, BR	1
Masindi, UG	1
Ilhéus, BR	1
UFSCarlocation not on record	1
Universidade Federal de Sergipe (UFS)location not on record	1
UESBlocation not on record	1
UFRPElocation not on record	1
UFMGlocation not on record	1

13 institutions · 24 of 24 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aristolochia eriantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)