Aristolochia clusii

Lojac. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records94

Data sources9

Biological traits4

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Aristolochia clusii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Aristolochia clusii is a species of plants in the family Aristolochiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction2

DeciduousnessEvergreen broad-leaved

Life formtuberous geophyte

Habitat & environment2

Climatesubtropical

Growth formclimber

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia clusii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKOK019259.1 ↗2 533 bpItaly

ACGT

TGCGACTATGATCTTTTACATATTTGGATGAAGCAACGAATTCGTCCATACCATTGGTAGAGTTTGTAAGACCACGACTGATCCAGAAGG …

Aristolochia clusii isolate P224 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aristolochia clusii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — NARDI E. - 1984. The genus "Aristolochia" L. (Aristolochiaceae) in Italy.. Webbia , 38: 221-300.

CCDB · ipcn-api-dl — Nardi, E. 1984. The genus Aristolochia L. (Aristolochiaceae) in Italy. Webbia 38: 221–300.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type94 records

Wild obs. + sensor67

Museum / vouchered27

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 29≤1 km 1≤10 km 8>10 km 3

41 georeferenced · 26 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dresden, DE	11
BIO-UNIPIlocation not on record	6
South Kensington, GB	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Berlin, DE	1
MAlocation not on record	1
Wlocation not on record	1

7 institutions · 26 of 27 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Aristolochia clusii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)