Aristolochia bracteolata

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records170

Data sources11

Biological traits15

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Aristolochia bracteolata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF170 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Aristolochia bracteolata also known as 'worm killer' in English due to its anthelminthic activity and trypanocidal effect, is a perennial herb growing from 10–60 cm tall. The plant is important in traditional medicine in Africa, India and the Middle East.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.3 m

Seed mass8.25 mg

Seed mass max10.1 mg

Seed mass min6.93 mg

Life cycle & reproduction3

Life formscrambling perennial

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formherb

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition3 compounds

Compounds documented for Aristolochia bracteolata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aporphine alkaloids2

Aporphine alkaloids $ Isoquinoline alkaloids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Magnoflorine	present	LOTUS
Aristolactam	present	LOTUS
Aristolochic Acid	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia bracteolata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences6

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMH216002.1 ↗518 bpIndia

ACGT

AAATTGACTTATTATACTCCTGAATATAAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCGGGGGTTCCGGCT …

Aristolochia bracteolata ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aristolochia bracteolata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Venugopalan, S. 1949 ; Sanjappa, M. & Sathyananda, N. 1979

CCDB · book-fedorov — Venugopalan 1949

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — Venugopalan 1949

n 61×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanjappa, M. 1979a. In IOPB chromosome number reports LXIV. Taxon 28: 393–395.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type170 records

Wild obs. + sensor80

Museum / vouchered90

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 17≤1 km 4≤10 km 3>10 km 1

25 georeferenced · 55 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 9≤10 km 3

12 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	16
Berlin, DE	12
Pondicherry, IN	7
Edinburgh, GB	6
Uniwersytet Śląski w Katowicachlocation not on record	5
Baroda, IN	5
Saint Louis, US	5
Wlocation not on record	4
Uppsala, SE	4
University of Stellenboschlocation not on record	2
Frankfurt am Main	2
South Kensington, GB	2
Plocation not on record	1
Pennsylvania Department of Agriculturelocation not on record	1
Bronx, US	1
Gujarat Biodiversity Gene Banklocation not on record	1

16 institutions · 74 of 90 vouchered records shown · 16 without an institution code

09Environmental DNA5 detections

Where the DNA of Aristolochia bracteolata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 16.2–16.2

Seasonal swing summer↔winter12.7 °C

Max temp (day)23.7 °C

Min temp (night)9.60 °C

Precipitation1.00 mm/mo

Air humidity43.6 %

Moisture balance-131 mm/mo

Vapour deficit1,031 Pa

Wind speed5.60 m/s

Cloud cover12.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)