Aristolochia baetica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records6 449

Data sources9

Biological traits10

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Aristolochia baetica's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 449 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF6 449 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aristolochia baetica, the Andalusian Dutchman's pipe or pipe vine, is a poisonous perennial vine that occurs in North Africa and the southern Iberian Peninsula, from Algeria to Portugal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height2.52 m

Seed mass28.16 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formclimbing shrub

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment4

Climatesubtropical

Climber detailedliana

Growth formliana

Woodinessvariable

03Chemical composition9 compounds

Compounds documented for Aristolochia baetica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Aporphine alkaloids4

Aporphine alkaloids $ Isoquinoline alkaloids2

Monosaccharides2

Disaccharides1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Magnoflorine	present	LOTUS
(6aS)-11-hydroxy-2,10-dimethoxy-6,6-dimethyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-6-ium-1-olate	present	LOTUS
Aristolactam	present	LOTUS
Aristolochic Acid	present	LOTUS
Aristolochic Acid Ii	present	LOTUS
Cepharanone B	present	LOTUS
D-(-)-Fructose	present	LOTUS
D-Fructose	present	LOTUS
Sugars	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia baetica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

matKEU531669.1 ↗786 bp

ACGT

TTTTTTTGAGGATCCACTGNTAATAATGAGAAATTTTTCTGCATATATGGCCAAATCGATCAATAATATCAAAATCGGACGAATCAGACC …

Aristolochia baetica isolate assem27.0.1 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aristolochia baetica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — R. Berjano,F. Roa,S. Talavera and M. Guerra. 2009. "Cytotaxonomy of diploid and polyploid Aristolochia (Aristolochiaceae) species based on the distribution of CMA/DAPI bands and 5S and 45S rDNA sites". Plant Systematics and Evolution 280:219-227.

08Occurrence & distribution

Record type6 449 records

Wild obs. + sensor6 015

Museum / vouchered434

Origin

Native5

Range

Area of Occupancy AOO9 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 3 454≤1 km 364≤10 km 657>10 km 51

4 526 georeferenced · 1 489 without coordinates

Open the mapobservation + sensor6 015

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 7≤1 km 123≤10 km 83>10 km 2

215 georeferenced · 219 without coordinates

Open the institutions mapphysical evidence434

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	73
BClocation not on record	49
Granada, ES	25
College of the Atlantic, Museumlocation not on record	20
València, ES	19
Salamanca, ES	15
Phyletisches Museum Jenalocation not on record	15
Alicante, ES	14
Barcelona, ES	14
ISAlocation not on record	13
Wlocation not on record	13
CICYTEXlocation not on record	13
Henry Brockhouse Collectionlocation not on record	11
Entomological Society of Latvialocation not on record	10
Córdoba, ES	10
Sevilla, ES	9
Dresden, DE	9
Badajoz, ES	9
Museo Achille Folettolocation not on record	8
Jaén, ES	8
Kew, GB	7
Madrid, ES	7
Museo della Bonifica di San Donà di Piavelocation not on record	6
Vitoria, ES	6
San Jose State University, Museum of Birds and Mammalslocation not on record	5
Universidad del Pais Vasco (UPV/EHU)location not on record	5
Paris, FR	4
LDlocation not on record	4
Frankfurt am Main	4
Pamplona, ES	3
Madrid, ES	3
San Sebastián, ES	3
Denver, US	2
Tilburg, NL	2
South Kensington, GB	2
Saint Louis, US	2
Xiamen, CN	1
JBCLMlocation not on record	1
Bourges, FR	1
Sevilla, ES	1
Edinburgh, GB	1
Oskarshamn, SE	1
Claremont, US	1
John May Museum of Natural Historylocation not on record	1
Gijón, ES	1

45 institutions · 431 of 434 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Aristolochia baetica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aristolochia baetica

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction4

Habitat & environment4

Compound class profile4 classes

Documented compounds9 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 449 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions29 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type6 449 records