Aristolochia argentina

Griseb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Piperales/Aristolochiaceae/Aristolochia

At a glance

Occurrence records252

Data sources7

Biological traits11

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Aristolochia argentina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF252 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aristolochia argentina Griseb. – gatunek rośliny z rodziny kokornakowatych. Występuje naturalnie w północnej części Argentyny, Paragwaju oraz Boliwii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.5 m

Life cycle & reproduction2

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formclimber

03Chemical composition10 compounds

Compounds documented for Aristolochia argentina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Aporphine alkaloids8

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Phenanthrenes1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
Aristolactam	present	LOTUS
Aristolactam bi	present	LOTUS
Aristolactam Ii	present	LOTUS
Aristolochic Acid	present	LOTUS
Aristolochic Acid Ii	present	LOTUS
Aristolochic Acid Iv	present	LOTUS
Aristoloside	present	LOTUS
Cepharanone B	present	LOTUS
Hayatine	present	LOTUS
Phenanthro(3,4-d)-1,3-dioxole-5-carboxylic acid, 10-methoxy-6-nitro-	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristolochia argentina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAB060787.1 ↗1 218 bp

ACGT

ATGTACTTGCTCATAATCATGATTTAAATGGATCAATTGTTTACGAATCGATGGAAAATTTAGGTTATGACAAAAGATTCAGTTCACTAA …

Aristolochia argentina chloroplast matK gene for maturase, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type252 records

Wild obs. + sensor148

Museum / vouchered103

Other1

Origin

Native50

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 51≤1 km 42≤10 km 9>10 km 2

104 georeferenced · 44 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 5≤10 km 8

13 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	52
San Jose State University, Museum of Birds and Mammalslocation not on record	8
Saint Louis, US	7
Corrientes, AR	4
San Isidro, AR	4
University of Stellenboschlocation not on record	3
Minia, EG	3
Bronx, US	2
Kew, GB	2
The University of Arizonalocation not on record	2
Castelar, AR	2
South Kensington, GB	2
Istituto Agrario Castelnuovolocation not on record	2
MAlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Christchurch, NZ	1
Glocation not on record	1
Universidad Nacional de La Patagonialocation not on record	1
Santa Cruz de la Sierra, BO	1

19 institutions · 99 of 103 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Aristolochia argentina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)