Aristida warburgii

Mez · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Aristida

At a glance

Occurrence records1 574

Data sources8

Biological traits28

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Aristida warburgii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 574 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF1 574 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Aristida warburgii is a species of grass (in the family Poaceae) that is native to New South Wales and Queensland. It was first described by Carl Christian Mez in 1921 from a specimen collected near Maryborough, Queensland. The species epithet, warburgii, honours Otto Warburg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length6.5 mm

Leaf length160 mm

Leaf size72 mm²

Leaf width1 mm

Plant height1.05 m

Plant height max1.2 m

Seed length6.5 mm

Life cycle & reproduction9

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life formperennial

Life spanperennial

Lifespan years25 years

⚠ sources differ — TRY: 25 years · AusTraits: 15 years

Pollination syndromewind

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristida warburgii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594136.1 ↗618 bpAustralia · 2018

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAGGTGTTGGATTTCAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACTCCGGAG …

Aristida warburgii voucher 600400532 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type1 574 records

Wild obs. + sensor1 060

Museum / vouchered401

Cultivated / captive1

Other112

Origin

Native77

Range

Area of Occupancy AOO3 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 934≤1 km 85≤10 km 22>10 km 6

1 047 georeferenced · 13 without coordinates

Open the mapobservation + sensor1 060

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 71≤1 km 25≤10 km 164>10 km 73

333 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence401

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	135
Mount Annan, AU	82
Canberra, AU	61
Museo Entomologico de Leonlocation not on record	22
NSW Dept of Planning, Industry and Environmentlocation not on record	19
Smithfield, AU	12
Kew, GB	11
Armidale, AU	10
Adelaide, AU	8
Palmerston, AU	8
Saint Louis, US	6
John T. Waterhouse Herbariumlocation not on record	4
NSW Office of Environment and Heritagelocation not on record	4
James Cook Townsvillelocation not on record	2
Wollongong, AU	2
Logan, US	1
University of the Sunshine Coastlocation not on record	1
Batemans Bay, AU	1

18 institutions · 389 of 401 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Aristida warburgii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 25.0–25.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)27.2 °C

Min temp (night)22.7 °C

Precipitation162 mm/mo

Air humidity60.8 %

Moisture balance-46.6 mm/mo

Vapour deficit1,235 Pa

Wind speed5.40 m/s

Cloud cover30.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aristida warburgii

At a glance

Sources8 archives

Size & morphology7

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Other traits1

At a glance

Record type1 574 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 574 records