Aristida californica — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Aristida

At a glance

Occurrence records254

Data sources9

Biological traits10

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Aristida californica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Aristida californica là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Thurb. mô tả khoa học đầu tiên năm 1880.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aristida californica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ171982.1 ↗593 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGCGAACGCGTCACCGTGCCGCCGGGCGTCTCCCACGGCGCCCGGCCCAGGCCCCCGACCTCCGTCC …

Aristida californica var. glabrata voucher Cerros 1908 RSA internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1rbcLaITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aristida californica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Reeder, J. R. & R. S. Felger. 1989. The Aristida californica--glabrata complex (Gramineae). Madroño 36(3): 187–197.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type254 records

Wild obs. + sensor16

Museum / vouchered238

Origin

Native14

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 13≤1 km 1

14 georeferenced · 2 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 50≤1 km 12≤10 km 23>10 km 2

87 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	42
University of Stellenboschlocation not on record	23
Ann Arbor, US	18
La Paz, MX	16
ASUlocation not on record	16
Claremont, US	16
Flagstaff, US	11
Saint Louis, US	10
Davis, US	9
San Diego, US	8
EL PASO, US	7
Austin, US	7
Hermosillo, MX	4
Irvine, US	4
Austin, US	3
Bronx, US	3
Santa Barbara, US	3
Phoenix, US	3
Arcata, US	3
Logan, US	2
Tampa, US	2
Canadian Department of Agriculturelocation not on record	2
Ensenada, MX	1
Henderson, US	1
US	1
Kew, GB	1
Northridge, US	1
Provo, US	1
San Angelo, US	1
Fullerton, US	1
CASlocation not on record	1
New Haven, US	1
Bloomington, US	1
Albuquerque, US	1
Angwin, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Calabar, NG	1
The University of Arizonalocation not on record	1

38 institutions · 228 of 238 vouchered records shown · 10 without an institution code

09Environmental DNA4 detections

Where the DNA of Aristida californica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Cercidium floridum ssp. floridum, Larrea tri…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 24.0–24.0

Seasonal swing summer↔winter19.5 °C

Max temp (day)30.1 °C

Min temp (night)17.4 °C

Precipitation10.5 mm/mo

Air humidity43.6 %

Moisture balance-120 mm/mo

Vapour deficit1,682 Pa

Wind speed3.20 m/s

Cloud cover19.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.