Arisaema sikokianum

Franch. & Sav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Arisaema

At a glance

Occurrence records116

Data sources11

Biological traits14

DNA specimens1

eDNA detections16

Sources11 archives

Databases and archives Arisaema sikokianum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 0 countries16 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Arisaema sikokianum, the Japanese Jack-in-the-pulpit, is a herbaceous perennial plant. An unusual woodland plant noted for its unmistakable smoky-purple base, snow-white cup and large hood with purple, green and white stripes. Found only in moist, shaded areas on the Island of Shikoku in Japan,Kew World Checklist of Selecte Plant Families it is closely related to Arisaema triphyllum, which is common to the eastern United States. In home gardens, it is a springtime planting and is often placed with shade-loving hostas and bleeding hearts. The plant is known to have existed and been admired in eighteenth century Japan. It may also cause contact irritation but is of little toxicologic importance.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass43.89 mg

Seed mass max43.89 mg

Seed mass min43.89 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Arisaema sikokianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carbocyclic fatty acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
13-Phenyltridecanoic acid		present	LOTUS
15-Phenylpentadecanoic acid		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arisaema sikokianum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections16

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJN090036.1 ↗501 bp

ACGT

CCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCT …

Arisaema sikokianum var. serratum voucher PS3012MT03 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arisaema sikokianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×CCDB · ipcn-api-dl · CCDB · araceae

CCDB · ipcn-api-dl — Murata, J. & M. Iijima. 1983. New or noteworthy chromosome records in Arisaema. J. Jap. Bot. 58(9): 270–280.

CCDB · ipcn-api-dl — Watanabe, K., T. Kobayashi & J. Marata. 1998. Cytology and systematics in Japanese Arisaema (Araceae). J. Pl. Res. 111: 509–521.

CCDB · araceae — Watanabe et al., 1998

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type116 records

Wild obs. + sensor40

Museum / vouchered75

Cultivated / captive1

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 17≤1 km 4≤10 km 4>10 km 7

32 georeferenced · 8 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 27

27 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence75

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	27
Hangzhou, CN	18
Beijing, CN	4
Wuhan, CN	4
Hokkaido University Museumlocation not on record	3
Shanghai, CN	3
Saint Louis, US	2
Guiyang, CN	2
University of Stellenboschlocation not on record	1
Nagasaki University - Fisherieslocation not on record	1
Guangzhou, CN	1
Zhejiang Museum of Natural Historylocation not on record	1
Wuhan, CN	1
Sanda, JP	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Lanzhou, CN	1
Xiamen, CN	1
Berlin, DE	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Guilin, CN	1

20 institutions · 75 of 75 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Arisaema sikokianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)