Arisaema propinquum

Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Arisaema

At a glance

Occurrence records68

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Arisaema propinquum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF68 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Arisaema propinquum, or Wallach's cobra lily, is a species of flowering plant the family Araceae. Arisaema propinquum occurs in the Himalayas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 300 m

Elevation min2 500 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arisaema propinquum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW828311.1 ↗752 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTATCCCACCACTCGACGCACTTGTGAATGGTTGACCCCTACCATCCCGGA …

Arisaema propinquum voucher 24231 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arisaema propinquum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–282n range26median26mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 269×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Mehra, P. N. & T. K. Pandita. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 405.

CCDB · ipcn-api-dl — Bhattacharya, G. N. 1978. Evolutionary role of B-chromosomes in Arisaema (Araceae). Proc. Indian Sci. Congr. Assoc. (IV, B) 67: 127.

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.

CCDB · book-indian_vol2 — Kumar, V. & Chauhan, K.P.S.

CCDB · book-indian_vol2 — Sharma, A. & Sarkar, A.K. 1967- 1968 ; Bhattacharyya, G.N. 1968

CCDB · book-indian_vol2 — Sharma, A. & Sarkar, S.K. 1967- 1968 ; Bhattacharyya, G.N. 1968 ; Mehra, P.N. & Pandita, T. K. 1979

2n 285×CCDB · book-ipcn73-74 · CCDB · book-indian_vol2 · CCDB · araceae

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

CCDB · book-indian_vol2 — Kurosawa, S. 1971b

CCDB · book-indian_vol2 — Malik, C.P. 1961b,c; Mehra, P.N. & Sachdeva, S.K. 1976d

CCDB · araceae — Petersen, 1989

n 143×CCDB · ipcn-api-dl · CCDB · araceae

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1976c. Cytological observations on some west Himalayan monocots. V. Araceae. Cytologia 41: 55–61.

CCDB · araceae — Mehra & Sachdeva, 1976

CCDB · araceae — Sharma, 1970

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type68 records

Wild obs. + sensor13

Museum / vouchered51

Cultivated / captive3

Other1

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 12 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence51

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	6
Edinburgh, GB	4
Kunming, CN	3
Philadelphia, US	2
Dehra Dun, IN	2
Kew, GB	1
Bronx, US	1
BMlocation not on record	1
South Kensington, GB	1
Xining, CN	1

10 institutions · 22 of 51 vouchered records shown · 29 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)