Arisaema consanguineum

Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Arisaema

At a glance

Occurrence records1 392

Data sources12

Biological traits12

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Arisaema consanguineum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 392 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionDukesPhytochem · NPASS21 compounds

Occurrence & distributionGBIF1 392 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Arisaema consanguineum, the Himalayan cobra lily, is a species of flowering plant in the arum lily family Araceae. Native to the Himalayas and Indochina, it is a tuberous perennial. A single stem, 1 m tall, bears a deciduous leaf with multiple radial leaflets. The flower is a deep maroon hooded spathe striped green and white. It appears in summer, and is followed by a cluster of brilliant red berries in autumn. It is cultivated as an ornamental plant for a permanently damp, sunny or partially shaded, sheltered spot, such as a woodland setting. Though hardy to -5 C, the tuber may require protection during winter. It is reported to cause indigestion and skin irritation if handled.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 900 m

Elevation min1 400 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition21 compounds

Compounds documented for Arisaema consanguineum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile2 classes

Monosaccharides2

Flavones1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
CALCIUM	1,550 ppm	DukesPhytochem
IRON	600 ppm	DukesPhytochem
POTASSIUM	180 ppm	DukesPhytochem
SODIUM	112 ppm	DukesPhytochem
MAGNESIUM	100 ppm	DukesPhytochem
ZINC	14 ppm	DukesPhytochem
COPPER	7 ppm	DukesPhytochem
MANGANESE	4 ppm	DukesPhytochem
ARSENIC	0.17 ppm	DukesPhytochem

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arisaema consanguineum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF913386.1 ↗235 bpChina

ACGT

CACATCATGTTGCCTACACAACACATCTTTGCTTGAAATGTGCGGTATGTGGGCGGAGCCTGGTCTCCTGTGCCTAGGGTACGGTTGGCC …

Arisaema consanguineum isolate TNX internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arisaema consanguineum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–562n range28median28mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 287×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +2

CCDB · ipcn-api-dl — Kuruvilla, K. M., B. Dutt & R. P. Roy. 1989. Karyomorphological investigations on aroids of North-Eastern Hills. J. Cytol. Genet. 24: 13–22.

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1978. Chromosomes and adaptation of some araceous members. Cell Chromosome Newslett. 1: 28.

CCDB · ipcn-api-dl — Sarkar, A. K. & U. Chatterjee. 1978. Cytological assessment of a few aroids of different habitat and geographical distribution to correlate their cyto-ecological relationship. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 110.

CCDB · book-ipcn67-71 — MEHRA, P.N . & S.K. SACHDEVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

CCDB · book-indian_vol2 — Kurosawa, S. 1971b ; Mehra, P.N. & Sachdeva, S.K. 1971 ; Sarkar, A.K. & Chatterjee, U. 1978

CCDB · araceae — Petersen, 1989

2n 482×CCDB · ipcn-api-dl · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Sarkar, A. K. & N. Datta. 1978. Cytological assessment of Indian Iphigenia (Liliaceae) to ascertain their mode of speciation. Bull. Bot. Soc. Bengal 32: 59–62.

CCDB · book-indian_vol2 — Sarkar, A.K., Datta, N. et al. 1978

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Murata, J. & M. Iijima. 1983. New or noteworthy chromosome records in Arisaema. J. Jap. Bot. 58(9): 270–280.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 392 records

Wild obs. + sensor615

Museum / vouchered753

Cultivated / captive23

Other1

Origin

Native11

Introduced1

Range

Area of Occupancy AOO2 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 273≤1 km 69≤10 km 30>10 km 23

395 georeferenced · 220 without coordinates

Open the mapobservation + sensor615

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 750 without coordinates

Open the institutions mapphysical evidence753

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy83% within 1 km

≤1 km 5≤10 km 1

6 georeferenced · 17 without coordinates

Open the mapnot free-living23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	376
Wuhan, CN	48
Kunming, CN	41
Taipei, TW	34
Taipei, TW	26
Taipei, TW	24
Xian, CN	21
Chengdu, CN	20
Nanjing, CN	15
Edinburgh, GB	12
TAIElocation not on record	11
Saint Louis, US	11
Zhengzhou, CN	9
Nanchong, CN	8
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	7
Chengdu, CN	7
Tianjin Natural History Museumlocation not on record	6
Central China Normal Universitylocation not on record	5
Hangzhou, CN	5
Cambridge, US	4
Shanxi Institute of Biologylocation not on record	4
Yunnan Universitylocation not on record	4
Xining, CN	4
Bronx, US	4
Yangling, CN	3
重庆市药物种植研究所药用植物标本馆location not on record	3
Moscow State Universitylocation not on record	3
Kew, GB	3
University of Stellenboschlocation not on record	2
Hebei Normal Universitylocation not on record	2
Berlin, DE	2
Strecker Museum, Baylor Universitylocation not on record	2
Wuhan, CN	2
Fort Worth, US	2
Seoul, KR	2
WNNUlocation not on record	2
South Kensington, GB	1
Vancouver, CA	1
JGSlocation not on record	1
Guilin, CN	1
CASlocation not on record	1
Shanghai, CN	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Lanzhou, CN	1
Awka, NG	1
Zunyi Normal Collegelocation not on record	1
Inner Mongolia Universitylocation not on record	1
Museum of the Rockieslocation not on record	1
Kathmandu, NP	1

49 institutions · 747 of 753 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Arisaema consanguineum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arisaema consanguineum

At a glance

Sources12 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Other traits1

Compound class profile2 classes

Documented compounds21 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 392 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions31 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 392 records