Arion vulgaris

Moquin-Tandon, 1855 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Arionidae/Arion

At a glance

Occurrence records32 795

Data sources10

Biological traits0

DNA specimens320

eDNA detections13

Sources10 archives

Databases and archives Arion vulgaris's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 795 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics320 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 795 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD320 specimens

Genome at a glanceGoaT · NCBI≈1.5 Gbp

01Narrative

The Spanish slug (Arion vulgaris, but also widely known as Arion lusitanicus owing to a misidentification) is an air-breathing land slug, a terrestrial pulmonate gastropod mollusk in the family Arionidae, the roundback slugs. It is a large, conspicuous slug, which has spread across much of Europe since the 1950s and now reached North America. It may attain high densities and be a serious horticultural and agricultural pest. The life cycle is annual, with adults appearing in summer and dying off before winter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding320 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arion vulgaris has left across the world's sequence archives.

At a glance

DNA specimens320

BINs11

Marker genes5

eDNA detections13

Countries30

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P594 bp consensus302 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

37Avariable

45Tmostly conserved

102Cmostly conserved

114Amostly conserved

115Cmostly conserved

147Tmostly conserved

150Tmostly conserved

151Cmostly conserved

168Cmostly conserved

213Gmostly conserved

216Cvariable

240Cmostly conserved

243Cmostly conserved

264Gvariable

291Cmostly conserved

292Tmostly conserved

315Tmostly conserved

330Cmostly conserved

360Tmostly conserved

424Tmostly conserved

427Tmostly conserved

430Tmostly conserved

447Gvariable

453Gmostly conserved

493Cmostly conserved

507Gmostly conserved

510Gmostly conserved

570Tvariable

573Gmostly conserved

576Amostly conserved

585Cmostly conserved

TCTCTTTTAATTCGCTTAGAGTTAGGAACAACTGGTATTTTAACTGATGATCAATTTTTTAATGTTATTATCACTGCACACGCTTTTGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 45 variants.

Diversity (π)1.9%

Haplotypes45

BINs11

Most divergent pair14.1%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

same genus3.0%Arion atersame genus10.3%Arion lusitanicussame genus11.1%same genus12.0%Arion baeticussame genus15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS116S18S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_046044 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND6ND5ND1ND4LCYTBCOX2ATP8ATP6ND3ND4COX3ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Arion vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 541 026 261 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arion vulgaris1.54 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness86.1% BUSCO

08Occurrence & distribution

Record type32 795 records

Wild obs. + sensor30 106

Museum / vouchered2 660

Cultivated / captive6

Other23

Origin

Native1

Introduced2 549

Range

Area of Occupancy AOO48 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 18 248≤1 km 6 028≤10 km 2 770>10 km 851

27 897 georeferenced · 2 209 without coordinates

Open the mapobservation + sensor30 106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 581≤1 km 318≤10 km 830>10 km 12

1 741 georeferenced · 919 without coordinates

Open the institutions mapphysical evidence2 660

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paro, BT	846
Gothenburg, SE	711
Bern, CH	327
Universität Zürich, Naturhistorisches Museumlocation not on record	99
SLU Artdatabankenlocation not on record	59
NTNU-VMlocation not on record	23
Helsinki, FI	18
SNSDlocation not on record	18
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	17
NNMLlocation not on record	16
YSU_MOL_MAlocation not on record	12
Musee d'Histoire Naturallelocation not on record	11
Barcelona, ES	7
BioFokuslocation not on record	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	7
Geneva, CH	6
Dhaka, BD	6
Naturama Aargaulocation not on record	5
Salzburg, AT	4
Kuopio, FI	4
Provincia di Livornolocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
Stockholm, SE	2
Tromsø, NO	1
Tartu, EE	1

25 institutions · 2 215 of 2 660 vouchered records shown · 444 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Arion vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 7.50–14.5

Seasonal swing summer↔winter18.6 °C

Max temp (day)17.0 °C 11.8–19.2

Min temp (night)7.70 °C 2.20–9.40

Precipitation101 mm/mo 49.3–110

Air humidity59.8 % 56.7–60.7

Moisture balance-8.70 mm/mo -36.9–18.5

Vapour deficit598 Pa 458–772

Wind speed2.80 m/s 2.50–4.20

Cloud cover37.0 % 36.9–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arion vulgaris

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type32 795 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type32 795 records