Arion intermedius

Normand, 1852 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Arionidae/Arion

At a glance

Occurrence records13 760

Data sources9

Biological traits0

DNA specimens50

eDNA detections284

Sources9 archives

Databases and archives Arion intermedius's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 760 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI284 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF13 760 records

Environmental DNA1 datasets · 1 countries284 detections

DNA & barcodingBOLD50 specimens

01Narrative

Arion intermedius is a species of land slug in the family Arionidae, the roundback slugs. It is known commonly as the hedgehog slug,Arion intermedius Normand. CSIRO & Australian Department of Agriculture, Fisheries and Forestry. 2004.Arion (Kobeltia) intermedius Normand, 1852 (hedgehog slug). MolluscIreland. National Museums Northern Ireland, 2010. hedgehog arion, or glade slug.Arion intermedius. NatureServe. 2013.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arion intermedius has left across the world's sequence archives.

At a glance

DNA specimens50

BINs4

Marker genes2

eDNA detections284

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 89 variable positions, in barcode order

1Avariable

2Cvariable

3Tmostly conserved

5Tmostly conserved

6Amostly conserved

8Amostly conserved

9Cmostly conserved

10Tmostly conserved

12Amostly conserved

13Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Gmostly conserved

20Gmostly conserved

21Amostly conserved

22Amostly conserved

23Tmostly conserved

24Tmostly conserved

25Tmostly conserved

28Amostly conserved

30Amostly conserved

31Gmostly conserved

32Gmostly conserved

33Tmostly conserved

34Tmostly conserved

36Amostly conserved

38Tvariable

40Gmostly conserved

41Gmostly conserved

42Tvariable

43Avariable

44Cvariable

46Gvariable

47Gvariable

48Amostly conserved

50Tmostly conserved

51Amostly conserved

52Tmostly conserved

53Cmostly conserved

54Tmostly conserved

55Tmostly conserved

57Amostly conserved

58Cmostly conserved

59Tmostly conserved

60Tmostly conserved

61Amostly conserved

62Tmostly conserved

63Tmostly conserved

64Cmostly conserved

65Gmostly conserved

66Gmostly conserved

67Tmostly conserved

68Tmostly conserved

69Amostly conserved

70Gmostly conserved

71Amostly conserved

72Gmostly conserved

73Tmostly conserved

74Tmostly conserved

76Gmostly conserved

77Gmostly conserved

78Amostly conserved

79Amostly conserved

80Cmostly conserved

82Amostly conserved

83Cmostly conserved

85Gmostly conserved

86Gmostly conserved

87Amostly conserved

88Amostly conserved

90Cmostly conserved

91Cvariable

92Tmostly conserved

94Amostly conserved

95Cmostly conserved

96Gmostly conserved

139Gmostly conserved

231Cmostly conserved

237Avariable

258Amostly conserved

336Cmostly conserved

372Tmostly conserved

507Amostly conserved

510Cvariable

538Tvariable

564Cmostly conserved

621Tmostly conserved

645Gmostly conserved

ACTTTATACTTAATTTTTGGAATTTGAAGAGGTTTAGTTGGTACAGGATTATCTTTACTTATTCGGTTAGAGTTAGGAACAACAGGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.0%

Haplotypes5

BINs2

Most divergent pair1.8%

EuropeS.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arion molinaesame genus17.6%Pseudocharopa whiteleggeisame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type13 760 records

Wild obs. + sensor12 316

Museum / vouchered1 443

Fossil1

Origin

Native94

Range

Area of Occupancy AOO34 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 3 288≤1 km 2 459≤10 km 5 720>10 km 148

11 615 georeferenced · 701 without coordinates

Open the mapobservation + sensor12 316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 342≤1 km 21≤10 km 175>10 km 1

539 georeferenced · 904 without coordinates

Open the institutions mapphysical evidence1 443

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	604
SLU Artdatabankenlocation not on record	274
Wellington, NZ	168
QVMAGlocation not on record	83
Chongqing Museumlocation not on record	40
Bern, CH	34
Museums Victorialocation not on record	22
Paro, BT	16
Barcelona, ES	14
Tasmanian Museum & Art Gallerylocation not on record	12
Victoria, CA	11
SNSDlocation not on record	10
Sydney, AU	8
Paris, FR	6
Chicago, US	6
BioFokuslocation not on record	5
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Los Angeles, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Natick, US	3
MZLUlocation not on record	2
fcnym.unlp.edu.arlocation not on record	2
Cambridge, US	2
Geneva, CH	2
Musee d'Histoire Naturallelocation not on record	2
Philadelphia, US	2
Royal Ontario Museumlocation not on record	1
Champaign, US	1
ELMClocation not on record	1
Auckland, NZ	1
North Carolina Museum of Natural Scienceslocation not on record	1
ZSMlocation not on record	1
Buenos Aires, AR	1
Helsinki, FI	1
Santa Barbara Museum of Natural Historylocation not on record	1
Universität Zürich, Naturhistorisches Museumlocation not on record	1

37 institutions · 1 353 of 1 443 vouchered records shown · 90 without an institution code

09Environmental DNA284 detections

Where the DNA of Arion intermedius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found284

Studies independent surveys1

Countries1

Verifiable raw sequence linked284

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 284 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.80 °C -4.80–18.2

Seasonal swing summer↔winter23.5 °C

Max temp (day)7.80 °C -0.8–21.7

Min temp (night)2.50 °C -8.40–15.7

Precipitation146 mm/mo 120–178

Air humidity62.9 % 61.5–65.8

Moisture balance99.6 mm/mo 1.20–144

Vapour deficit320 Pa 159–708

Wind speed3.40 m/s 2.70–4.00

Cloud cover46.3 % 42.8–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 284 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arion intermedius

At a glance

Sources9 archives

At a glance

Record type13 760 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 760 records