Arion hortensis

A.Férussac, 1819 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Arionidae/Arion

At a glance

Occurrence records5 872

Data sources7

Biological traits0

DNA specimens62

eDNA detections2

Sources7 archives

Databases and archives Arion hortensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 872 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 872 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD62 specimens

01Narrative

Arion hortensis, also known by its common name the "garden slug", "small striped slug" or "black field slug" is a species of small air-breathing land slug, a terrestrial pulmonate gastropod mollusk in the family Arionidae, the roundback slugs. In Britain, the name Arion hortensis was previously applied to a species complex, consisting of this species plus Arion distinctus Mabille, 1868 and Arion owneii Davies, 1979. Here the name is used sensu stricto.Michael Kerney. 1999. Atlas of the land and freshwater Molluscs of Britain and Ireland. Harley Books, Colchester Essex. .

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arion hortensis has left across the world's sequence archives.

At a glance

DNA specimens62

BINs6

Marker genes4

eDNA detections2

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

2Tvariable

3Avariable

4Avariable

6Cvariable

7Cvariable

8Gvariable

10Cvariable

12Tvariable

13Gvariable

14Avariable

15Gvariable

18Cvariable

20Gvariable

21Tvariable

22Avariable

23Cvariable

24Tvariable

25Avariable

26Cvariable

27Cvariable

28Gvariable

29Gvariable

30Gvariable

33Cmostly conserved

35Tvariable

36Tvariable

37Tvariable

39Avariable

40Avariable

41Cvariable

42Tvariable

43Gvariable

44Avariable

69Cmostly conserved

135Amostly conserved

183Tmostly conserved

216Cmostly conserved

240Amostly conserved

243Amostly conserved

258Tmostly conserved

276Gmostly conserved

288Tmostly conserved

315Gvariable

357Gmostly conserved

366Tmostly conserved

396Gmostly conserved

453Tmostly conserved

519Gmostly conserved

531Cmostly conserved

570Gmostly conserved

573Tmostly conserved

579Cmostly conserved

591Cmostly conserved

TTAATCCGACTTGAGCTCGGTACTACCGGGACCGTTTTAACTGATGATGATCAATTTTTTAACGTTATCGTTACTGCTCACGCTTTTGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes7

BINs3

Most divergent pair19.6%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS116S18S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type5 872 records

Wild obs. + sensor5 142

Museum / vouchered729

Fossil1

Origin

Native193

Range

Area of Occupancy AOO13 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 2 033≤1 km 723≤10 km 1 826>10 km 143

4 725 georeferenced · 417 without coordinates

Open the mapobservation + sensor5 142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 261≤1 km 13≤10 km 185>10 km 3

462 georeferenced · 267 without coordinates

Open the institutions mapphysical evidence729

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	134
Bern, CH	77
Paro, BT	67
Chongqing Museumlocation not on record	41
QVMAGlocation not on record	23
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	21
Los Angeles, US	18
Philadelphia, US	15
Chicago, US	15
Victoria, CA	8
Barcelona, ES	8
Tromsø, NO	4
Delaware Museum of Nature and Sciencelocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Cambridge, US	3
Royal Museum for Central Africalocation not on record	3
NNMLlocation not on record	2
Museums Victorialocation not on record	2
CASlocation not on record	2
Dhaka, BD	2
Santa Barbara Museum of Natural Historylocation not on record	1
Ann Arbor, US	1
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
ZSMlocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1

26 institutions · 457 of 729 vouchered records shown · 272 without an institution code

09Environmental DNA2 detections

Where the DNA of Arion hortensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arion hortensis

At a glance

Sources7 archives

At a glance

Record type5 872 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 872 records