Ariomma regulus

(Poey, 1868) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Ariommatidae/Ariomma

At a glance

Occurrence records285

Data sources9

Biological traits7

DNA specimens4

eDNA detections1

Sources9 archives

Databases and archives Ariomma regulus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

OBISOcean Biodiversity Information System182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS285 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD4 specimens

01Narrative

Ariomma regulus is een straalvinnige vis uit de familie van Ariommatidae, orde baarsachtigen (Perciformes), die voorkomt in het noordwesten, het westen en het zuidwesten van de Atlantische Oceaan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max500 m

Depth min0 m

Vulnerability15

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariomma regulus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 102 variable positions, in barcode order

34Gmostly conserved

37Gmostly conserved

40Cmostly conserved

43Cmostly conserved

55Amostly conserved

58Tmostly conserved

94Gmostly conserved

106Amostly conserved

109Gmostly conserved

112Tmostly conserved

121Cmostly conserved

133Cmostly conserved

136Cmostly conserved

169Cmostly conserved

172Amostly conserved

181Amostly conserved

193Gmostly conserved

199Cmostly conserved

202Amostly conserved

208Amostly conserved

214Amostly conserved

235Tmostly conserved

244Cmostly conserved

250Gmostly conserved

256Cmostly conserved

259Gmostly conserved

260Cmostly conserved

262Tmostly conserved

263Tmostly conserved

265Amostly conserved

268Amostly conserved

271Cmostly conserved

280Amostly conserved

281Cmostly conserved

287Tmostly conserved

292Cmostly conserved

295Tmostly conserved

298Tmostly conserved

301Gmostly conserved

304Tmostly conserved

307Amostly conserved

310Amostly conserved

313Cmostly conserved

331Amostly conserved

334Tmostly conserved

340Cmostly conserved

344Tmostly conserved

352Cmostly conserved

356Tmostly conserved

361Amostly conserved

367Tmostly conserved

376Amostly conserved

383Tmostly conserved

388Tmostly conserved

391Tmostly conserved

394Tmostly conserved

397Tmostly conserved

398Cmostly conserved

400Amostly conserved

403Tmostly conserved

406Amostly conserved

412Amostly conserved

413Gmostly conserved

415Tmostly conserved

427Cmostly conserved

433Amostly conserved

439Cmostly conserved

442Cmostly conserved

445Cmostly conserved

460Cmostly conserved

463Amostly conserved

475Tmostly conserved

481Cmostly conserved

484Amostly conserved

487Cmostly conserved

496Tmostly conserved

497Tmostly conserved

505Gmostly conserved

509Gmostly conserved

511Tmostly conserved

514Cmostly conserved

515Cmostly conserved

517Tmostly conserved

526Tmostly conserved

529Tmostly conserved

532Cmostly conserved

541Amostly conserved

544Amostly conserved

547Cmostly conserved

550Tmostly conserved

556Amostly conserved

562Tmostly conserved

565Cmostly conserved

568Cmostly conserved

577Amostly conserved

604Cmostly conserved

613Tmostly conserved

616Tmostly conserved

622Amostly conserved

628Tmostly conserved

637Cmostly conserved

643Cmostly conserved

CCTATATCTAGTATTTGGTGCATGAGCTGGAATGGTGGGCACCGCCTTAAGCCTACTTATCCGAGCTGAACTAAACCAACCAGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.8%

Haplotypes3

BIN1

Most divergent pair15.6%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ariomma indicumsame genus7.9%Ariomma melanumsame genus8.3%Ariomma bondisame genus9.4%Cubiceps gracilissame order12.0%Cubiceps paradoxussame order12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082749 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type285 records

Wild obs. + sensor131

Museum / vouchered154

Origin

Native1

Range

Area of Occupancy AOO724 km²

Depth

0–200 m sunlit80

200–1000 m twilight23

1–4 km midnight0

>4 km abyssal0

median 31 m · max 350 m · 103 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 9

10 georeferenced · 121 without coordinates

Open the mapobservation + sensor131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9>10 km 11

20 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	27
FishBaselocation not on record	13
Washington, US	12
Cambridge, US	8
North Carolina Museum of Natural Scienceslocation not on record	3
Chicago, US	2
New Haven, US	1
Wuzhou, CN	1
CASlocation not on record	1
Vancouver, CA	1
Southeastern Louisiana University, Vertebrate Museumlocation not on record	1
University of Alabamalocation not on record	1
University of California San Diegolocation not on record	1
Ann Arbor, US	1

14 institutions · 73 of 154 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ariomma regulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)