Ariocarpus retusus

Scheidw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Ariocarpus

At a glance

Occurrence records208

Data sources14

Biological traits8

DNA specimens8

eDNA detections8

Sources14 archives

Databases and archives Ariocarpus retusus's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF208 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB · TreeOfSex2n = 22

01Narrative

Ariocarpus retusus is a species of cactus, from the genus Ariocarpus, found mainly in Mexico. It is one of the largest and fastest-growing species in this genus known for a slow rate of growth. Despite its slow growth, often taking ten years to reach flowering age, the retusus is a desirable cactus for cultivation, having attractive flowers and an unusual form for a cactus. It is also one of the most easily cultivated species in the genus. Flowering Ariocarpus retusus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass0.089 mg

Seed mass max0.089 mg

Seed mass min0.089 mg

Life cycle & reproduction1

Life formsucculent subshrub

Habitat & environment3

Climatedesert or dry shrubland

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Ariocarpus retusus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Friedelane triterpenoids2

Phenylethylamines1

Amarylidaceae alkaloids $ Phenylethylamines1

Flavonols1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
20Alpha-Hydroxytingenone	present	NPASS
Hordenine	present	LOTUS
N-Methyltyramine	present	LOTUS
Pristimerin	present	NPASS
Salaspermic Acid	present	NPASS
Tetramethylquercetin	present	LOTUS
Tingenone	present	NPASS
WQWVVEFJOYBRTQ-DDOYSYFBSA-N	present	NPASS
YVLKHYOFENMOAK-UMTXDNHDSA-N	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariocarpus retusus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences7

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON176046.1 ↗374 bpMexico · 2020

ACGT

GCATCGCGCCTCCCCCCCGCCCGCCGGGGGGAAGGATGATGGCCTCCCGTGCCCCAGTCGGGGCGCGGCTGGCCTAAAATGGGAGCCCGC …

Ariocarpus retusus voucher LFM003 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Ariocarpus retusus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×CCDB · ipcn-api-dl · CCDB · book-fedorov · TreeOfSex · plant

CCDB · ipcn-api-dl — Das, A. B., S. Mohanty, R. H. Marrs & P. Das. 1999. Somatic chromosome number and karyotype diversity in fifteen species of Mammillaria of the family Cactaceae. Cytobios 97: 141–151.

CCDB · book-fedorov — Anderson E. F. 1962

CCDB · book-fedorov — Remski 1954

TreeOfSex · plant — Goldblatt1979 ↗

n 113×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Gill, B. S. & V. Goyal. 1984. Cytology of some members of Cactaceae. Cell Chromosome Res. 7: 58–60.

CCDB · ipcn-api-dl — Mohanty, S., A. B. Das & P. Das. 1997. Studies on nuclear DNA and meiotic chromosomes in 8 species on Mammillaria. Cytologia 62: 331–336.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type208 records

Wild obs. + sensor104

Museum / vouchered104

Range

Area of Occupancy AOO748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 1>10 km 103

104 georeferenced

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 84≤10 km 1>10 km 2

87 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	83
Saint Louis, US	9
Kew, GB	3
MEXUlocation not on record	2
Durango, MX	2
Phoenix, US	1
Giardini Botanici Hanburylocation not on record	1
San Diego, US	1
Juriquilla, MX	1

9 institutions · 103 of 104 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Ariocarpus retusus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)