Ariocarpus fissuratus

(Engelm.) K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Ariocarpus

At a glance

Occurrence records133

Data sources12

Biological traits9

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Ariocarpus fissuratus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionNPASS67 compounds

Occurrence & distributionGBIF133 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Ariocarpus fissuratus (formerly known as Anhalonium fissuratus) is a species of cactus found in small numbers in northern Mexico and Texas in the United States. Common names include living rock cactus, false peyote, chautle, dry whiskey and star cactus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinessnon-woody

03Chemical composition67 compounds

Compounds documented for Ariocarpus fissuratus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Imidazole alkaloids14

Dihydroflavonols6

Cadinane sesquiterpenoids4

Menthane monoterpenoids3

Acyclic monoterpenoids3

Documented compounds67 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Betulonic acid	present	NPASS
(+)-Erythrodiol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(+)-Yangambin	present	NPASS
(-)-Isopulegol	present	NPASS
(1R,2S,4R)-2-Hydroxy-alpha,alpha,4-trimethylcyclohexanemethanol	present	NPASS
(1R,4S,4aR,7S,8aR)-1,6-dimethyl-4-propan-2-yl-3,4,4a,7,8,8a-hexahydro-2H-naphthalene-1,7-diol	present	NPASS
(1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(2R,3R)-3,4'-Dihydroxy-5,7-dimethoxyflavone	present	NPASS
(2R,3R)-3,5,7-trihydroxy-2-(4-hydroxyphenyl)-6-[(1R)-1-(4-hydroxyphenyl)ethyl]-2,3-dihydrochromen-4-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariocarpus fissuratus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK449087.1 ↗539 bp

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Ariocarpus fissuratus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Ariocarpus fissuratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–382n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Weedin, J. F. & A. M. Powell. 1978. Chromosome numbers in Chihuahuan desert Cactaceae. Trans-Pecos Texas. Amer. J. Bot. 65: 531–537.

CCDB · book-fedorov — Anderson E. F. 1962

2n 381×CCDB · book-fedorov

CCDB · book-fedorov — Takagi 1938

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type133 records

Wild obs. + sensor101

Museum / vouchered29

Cultivated / captive3

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 10≤1 km 2≤10 km 2>10 km 83

97 georeferenced · 4 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 16

16 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	11
Guasave, MX	7
Durango, MX	3
Austin, US	2
Kew, GB	2
Riverside, US	1
Saint Louis, US	1
Austin, US	1

8 institutions · 28 of 29 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Ariocarpus fissuratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)