Aridelus rufotestaceus

Tobias, 1986 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aridelus

At a glance

Occurrence records31

Data sources6

Biological traits0

DNA specimens7

eDNA detections7

Sources6 archives

Databases and archives Aridelus rufotestaceus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aridelus rufotestaceus is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Tobias in 1986.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aridelus rufotestaceus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes2

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.6%

Haplotypes1

BINs2

Where individuals differ — all 52 variable positions, in barcode order

5Tmostly conserved

43Amostly conserved

88Cmostly conserved

103Tmostly conserved

106Tmostly conserved

115Cmostly conserved

118Tmostly conserved

119Amostly conserved

120Gmostly conserved

121Amostly conserved

136Tmostly conserved

163Tmostly conserved

190Avariable

193Cmostly conserved

202Tmostly conserved

220Tmostly conserved

229Amostly conserved

235Tvariable

241Amostly conserved

250Tmostly conserved

277Cmostly conserved

285Tmostly conserved

292Tmostly conserved

311Tmostly conserved

322Avariable

340Tmostly conserved

352Tvariable

364Tmostly conserved

373Amostly conserved

385Tmostly conserved

386Tmostly conserved

388Amostly conserved

406Cmostly conserved

418Tmostly conserved

430Gmostly conserved

433Amostly conserved

439Cmostly conserved

472Amostly conserved

529Cmostly conserved

541Cmostly conserved

544Cmostly conserved

553Tmostly conserved

556Tmostly conserved

577Avariable

586Cvariable

592Amostly conserved

601Cvariable

613Cvariable

616Cvariable

637Avariable

638Gvariable

640Cvariable

AATTTTATATTTTATTTTTGGAATTTGAGCAGGATTTATTGGATTATCCTTAAGAATAATTATCCGATTAGAATTAGGAACAACAAACTC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type31 records

Wild obs. + sensor17

Museum / vouchered14

Origin

Introduced10

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 11≤1 km 2≤10 km 1

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	10
Auckland, NZ	4

2 institutions · 14 of 14 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Aridelus rufotestaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 14.6–19.3

Seasonal swing summer↔winter7.70 °C

Max temp (day)17.9 °C 16.3–21.1

Min temp (night)15.2 °C 12.9–17.2

Precipitation110 mm/mo 84.0–173

Air humidity60.6 % 60.4–64.9

Moisture balance-37.5 mm/mo -64.5–72.0

Vapour deficit643 Pa 634–864

Wind speed5.40 m/s 4.50–5.40

Cloud cover36.5 % 17.0–36.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)