Ariadne merione

(Cramer, 1779) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Ariadne

At a glance

Occurrence records3 861

Data sources7

Biological traits0

DNA specimens15

eDNA detections19

Sources7 archives

Databases and archives Ariadne merione's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 861 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 861 records

Environmental DNA1 datasets · 3 countries19 detections

DNA & barcodingBOLD15 specimens

01Narrative

Ariadne merione, the common castor, is an orange butterfly with brown lines whose larvae feed almost exclusively on castor (Ricinus communis). It is similar in appearance to Ariadne ariadne, the angled castor. This species is found in south and southeast Asia. Their wingspan ranges between 30–35 mm. Like others in the family Nymphalidae, their front two legs are small and unused, effectively making them four legged. These smaller appendages are covered with long hairs, giving them the characteristic brush look.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariadne merione has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P597 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

100Gmostly conserved

141Amostly conserved

418Amostly conserved

525Gvariable

ATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes4

BIN1

Most divergent pair0.34%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mestra amymonesame family7.4%Byblia anvatarasame family7.5%Mestra dorcassame family7.5%Mestra hersiliasame family7.6%Phyllophila obliteratasame order8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 861 records

Wild obs. + sensor3 832

Museum / vouchered29

Range

Area of Occupancy AOO5 636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 962≤1 km 1 251≤10 km 384>10 km 152

2 749 georeferenced · 1 083 without coordinates

Open the mapobservation + sensor3 832

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 4≤10 km 4>10 km 13

21 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Tribhuvan Universitylocation not on record	7
Brussels, BE	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
RBINS-Scientific Heritagelocation not on record	1
MZLUlocation not on record	1

5 institutions · 11 of 29 vouchered records shown · 17 without an institution code

09Environmental DNA19 detections

Where the DNA of Ariadne merione was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 20.7–27.0

Seasonal swing summer↔winter20.2 °C

Max temp (day)29.6 °C 26.6–33.8

Min temp (night)19.0 °C 14.7–21.2

Precipitation101 mm/mo 5.30–270

Air humidity54.1 % 45.9–62.6

Moisture balance-34.2 mm/mo -133–140

Vapour deficit1,293 Pa 1,111–1,935

Wind speed2.10 m/s 1.50–2.50

Cloud cover29.6 % 16.1–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ariadne merione

At a glance

Sources7 archives

At a glance

Record type3 861 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 861 records