Ariadne ariadne

(Linnaeus, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Ariadne

At a glance

Occurrence records2 889

Data sources7

Biological traits0

DNA specimens41

eDNA detections29

Sources7 archives

Databases and archives Ariadne ariadne's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 889 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 889 records

Environmental DNA1 datasets · 6 countries29 detections

DNA & barcodingBOLD41 specimens

01Narrative

Ariadne ariadne, the angled castor, is a species of nymphalid butterfly found in Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariadne ariadne has left across the world's sequence archives.

At a glance

DNA specimens41

BINs6

Marker genes12

eDNA detections29

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

43Amostly conserved

49Tmostly conserved

56Tmostly conserved

64Tmostly conserved

79Amostly conserved

82Cmostly conserved

85Tvariable

88Tmostly conserved

91Amostly conserved

97Cmostly conserved

100Amostly conserved

106Tmostly conserved

121Amostly conserved

127Tmostly conserved

133Tmostly conserved

157Tmostly conserved

169Cvariable

178Tmostly conserved

181Amostly conserved

197Cmostly conserved

202Tmostly conserved

211Gmostly conserved

217Amostly conserved

220Cmostly conserved

235Cmostly conserved

238Amostly conserved

265Tmostly conserved

282Tmostly conserved

295Amostly conserved

313Tmostly conserved

316Amostly conserved

319Cmostly conserved

337Amostly conserved

343Cvariable

346Amostly conserved

347Cmostly conserved

352Tmostly conserved

364Tmostly conserved

367Tmostly conserved

369Cmostly conserved

370Cmostly conserved

373Tmostly conserved

374Gmostly conserved

376Amostly conserved

382Amostly conserved

403Amostly conserved

407Tmostly conserved

412Amostly conserved

424Tmostly conserved

433Gvariable

436Amostly conserved

457Cvariable

499Tvariable

500Tmostly conserved

508Cmostly conserved

517Tvariable

520Amostly conserved

529Cmostly conserved

530Cmostly conserved

542Cvariable

550Amostly conserved

562Tmostly conserved

578Cmostly conserved

592Amostly conserved

598Tmostly conserved

601Tmostly conserved

604Amostly conserved

607Cmostly conserved

610Cmostly conserved

622Cmostly conserved

628Gvariable

631Amostly conserved

646Cmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACATCTCTTAGTTTAATAATTCGAACAGAATTAGGAAACCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes12

BINs6

Most divergent pair7.8%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tricypha nigrescenssame order8.8%Byblia anvatarasame family9.0%Catonephele oritessame family9.4%Myscelia patteniasame family9.4%Neptidopsis fulguratasame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_026069 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1LSUSSU

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type2 889 records

Wild obs. + sensor2 650

Museum / vouchered207

Other32

Range

Area of Occupancy AOO5 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 608≤1 km 744≤10 km 331>10 km 217

1 900 georeferenced · 750 without coordinates

Open the mapobservation + sensor2 650

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 12≤10 km 48>10 km 126

186 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	8
Natural History Museum, Tribhuvan Universitylocation not on record	8
Natural History Museum Rotterdamlocation not on record	6
MZLUlocation not on record	5
New Haven, US	4
Durban Natural Science Museumlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Chinese Academy of Sciences, Kunming Institute of Zoologylocation not on record	2
Denver, US	1
Naresuan Universitylocation not on record	1
Smithsonian Tropical Research Institute, Center for Tropical Forest Science, Khao Chong, Arthropod Laboratorylocation not on record	1
Brussels, BE	1

12 institutions · 43 of 207 vouchered records shown · 162 without an institution code

09Environmental DNA29 detections

Where the DNA of Ariadne ariadne was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map6 countries0

Park

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 24.1–28.0

Seasonal swing summer↔winter13.3 °C

Max temp (day)29.4 °C 26.5–30.5

Min temp (night)23.1 °C 18.4–25.5

Precipitation248 mm/mo 109–406

Air humidity67.3 % 57.4–69.1

Moisture balance124 mm/mo -13.4–257

Vapour deficit1,230 Pa 982–1,527

Wind speed2.40 m/s 1.80–3.00

Cloud cover55.0 % 29.9–70.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ariadne ariadne

At a glance

Sources7 archives

At a glance

Record type2 889 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 889 records