Ariadna bicolor

(Hentz, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Segestriidae/Ariadna

At a glance

Occurrence records554

Data sources9

Biological traits3

DNA specimens17

eDNA detections5

Sources9 archives

Databases and archives Ariadna bicolor's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility554 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider Trait DBMasaryk University3 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources3 traits

Occurrence & distributionGBIF554 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD17 specimens

01Narrative

Ariadna bicolor is a tube-dwelling spider. Found in North America, the spider's cephalothorax and legs are yellowish-brown and its abdomen is purplish-brown. John Henry Comstock said that the habitats of the species are remarkable. He brought the spiders from Ithaca and made them a home that had blocks nailed together that each had a hole. The spiders used the man-made habitat as a nest. In a test about what species of spider replied the fastest to odors, Ariadna bicolor responded slowly. When they weren't in their tubes, they responded in 63 seconds to five oils. When they were in their tubes, they didn't respond to the odors at all.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesForster et al. 1987Pekár 2014aEiseman et al. 2010

Predation1

Web buildingyes

Anatomy1

Posterior respiratory systemtubular_tracheae

Defence1

Retreattube web

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ariadna bicolor has left across the world's sequence archives.

At a glance

DNA specimens17

BINs5

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BINs5

Most divergent pair0.92%

Where individuals differ — all 38 variable positions, in barcode order

2Tmostly conserved

19Gmostly conserved

40Tmostly conserved

55Tmostly conserved

85Gmostly conserved

109Gmostly conserved

112Tmostly conserved

145Gmostly conserved

172Amostly conserved

181Gmostly conserved

199Cvariable

209Cmostly conserved

214Tvariable

265Gmostly conserved

268Avariable

277Amostly conserved

283Avariable

287Cmostly conserved

316Tmostly conserved

334Tmostly conserved

349Tmostly conserved

376Cmostly conserved

382Cvariable

397Tmostly conserved

398Tmostly conserved

412Amostly conserved

427Gvariable

448Gmostly conserved

463Gmostly conserved

484Gmostly conserved

487Avariable

514Tvariable

523Cvariable

530Tmostly conserved

550Avariable

592Tvariable

625Gmostly conserved

631Tvariable

TTTGTATTTGTTGTTTGGGGCTTGGGCGGCGATAGCGGGTACTGCAATAAGTGTTTTAATTCGTGTAGAGTTGGGGCAGGTGGGGAGTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mesostalita kratochvilisame order17.3%Brachypelma smithisame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type554 records

Wild obs. + sensor388

Museum / vouchered166

Range

Area of Occupancy AOO1 804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 196≤1 km 36≤10 km 14>10 km 82

328 georeferenced · 60 without coordinates

Open the mapobservation + sensor388

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 5≤1 km 4≤10 km 15>10 km 10

34 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	46
Cambridge, US	30
College Station, US	29
Washington, US	16
CASlocation not on record	15
Denver, US	8
San Francisco, US	4
Centre for Biodiversity Genomicslocation not on record	4
US	3
Albuquerque, US	2
Lubbock, US	2
University of Indianapolislocation not on record	1
Philadelphia, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Cincinnati, US	1
	1
Chicago, US	1
Champaign, US	1

18 institutions · 166 of 166 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Ariadna bicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

bathroom wall

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 15.5–25.6

Seasonal swing summer↔winter20.6 °C

Max temp (day)26.9 °C 18.1–30.8

Min temp (night)17.5 °C 13.7–20.7

Precipitation93.3 mm/mo 73.6–100

Air humidity58.3 % 55.0–61.1

Moisture balance-60.0 mm/mo -99.2–-35.5

Vapour deficit1,024 Pa 732–1,478

Wind speed3.50 m/s 1.80–6.70

Cloud cover29.4 % 26.6–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)