Aria porrigentiformis

(E.F.Warb.) Sennikov & Kurtto · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Aria

At a glance

Occurrence records7

Data sources8

Biological traits13

DNA specimens0

eDNA detections5

Sources8 archives

Databases and archives Aria porrigentiformis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT1.5 Gbp

01Narrative

Sorbus porrigentiformis, the grey-leafed whitebeam, is a species of whitebeam endemic to England and Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Leaf size3 162 mm²

Plant height5 m

Seed mass12.32 mg

⚠ sources differ — TRY: 12.32 mg · LEDA: 16.21 mg · GIFT: 13.93 mg

Seed mass max16.2 mg

Seed mass min6.43 mg

Life cycle & reproduction3

Deciduousnessaestival

Life formtree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aria porrigentiformis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX166263.1 ↗440 bpUnited Kingdom · 2002

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCC …

Aria porrigentiformis voucher NMW4552 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aria porrigentiformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 475 802 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aria porrigentiformis1.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidy4× tetraploid · measured

Chromosome records34–682n range68median68mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 686×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +1

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · brit-fl — Proctor, M.C.F., Groenhof, A.C. Watsonia 19: 21-37 (1992)

CCDB · brit-fl — McAllister, H. Pers.comm. to R.J.Gornall : 8.x (1992)

CCDB · kew — Pellicer J, Clermont S, Houston L, Rich TCG, Fay MF. 2012. Cytotype diversity in the Sorbus complex (Rosaceae) in Britain: sorting out the puzzle. Annals of Botany 110: 1185-1193

2n 342×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · brit-fl — McAllister, H. Pers.comm. to R.J.Gornall : 8.x (1992)

2n 512×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · fl-europaea

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · fl-europaea — Warburg, 1952

2n 871×GoaT · DTOL Flowering Plants Estimates Kew

GoaT · DTOL Flowering Plants Estimates Kew

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rotorua, NZ	1

1 institutions · 1 of 7 vouchered records shown · 6 without an institution code

09Environmental DNA5 detections

Where the DNA of Aria porrigentiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 11.9–14.2

Seasonal swing summer↔winter11.3 °C

Max temp (day)15.6 °C 15.4–16.7

Min temp (night)8.70 °C 7.60–11.6

Precipitation88.2 mm/mo 70.2–109

Air humidity65.4 % 62.0–66.8

Moisture balance-7.00 mm/mo

Vapour deficit537 Pa 486–569

Wind speed4.70 m/s

Cloud cover48.8 % 43.1–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)