Aria lancastriensis

(E.F.Warb.) Sennikov & Kurtto · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Aria

At a glance

Occurrence records4

Data sources9

Biological traits14

DNA specimens0

eDNA detections5

Sources9 archives

Databases and archives Aria lancastriensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources14 traits

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT1.5 Gbp

01Narrative

Sorbus lancastriensis, the Lancastrian whitebeam, is a species of deciduous tree or shrub in the family Rosaceae, growing to 6 m. It is endemic to England, and is found within a 30 km radius from Morecambe Bay, in Lancashire. It is threatened by habitat loss. It has oval leaves. White blossom in spring is followed by orange to red berries in autumn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Leaf size3 162 mm²

Plant height5 m

Seed mass15.43 mg

Seed mass max15.91 mg

Seed mass min14.51 mg

Life cycle & reproduction4

Deciduousnessaestival

Dispersal typeanimal

Life formtree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aria lancastriensis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX166673.1 ↗440 bpUnited Kingdom · 2002

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCC …

Aria lancastriensis voucher NMW8182 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aria lancastriensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 467 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aria lancastriensis1.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidy4× tetraploid · measured

Chromosome records68–682n range68median68mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 685×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +2

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · brit-fl — McAllister, H. Pers.comm. to R.J.Gornall : 8.x (1992)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2753

CCDB · kew — Pellicer J, Clermont S, Houston L, Rich TCG, Fay MF. 2012. Cytotype diversity in the Sorbus complex (Rosaceae) in Britain: sorting out the puzzle. Annals of Botany 110: 1185-1193

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 records

Wild obs. + sensor3

Museum / vouchered1

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA5 detections

Where the DNA of Aria lancastriensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 12.2–15.1

Seasonal swing summer↔winter11.2 °C

Max temp (day)16.2 °C 15.1–17.2

Min temp (night)10.5 °C 8.30–12.4

Precipitation129 mm/mo 100–142

Air humidity66.4 % 65.9–66.8

Moisture balance32.4 mm/mo -3.70–63.5

Vapour deficit532 Pa 476–587

Wind speed4.60 m/s 3.70–5.30

Cloud cover49.0 % 48.5–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)