Aria hibernica

(E.F.Warb.) Sennikov & Kurtto · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Aria

At a glance

Occurrence records10

Data sources6

Biological traits13

DNA specimens0

eDNA detections4

Sources6 archives

Databases and archives Aria hibernica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.54 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT1.5 Gbp

01Narrative

Sorbus hibernica, the Irish whitebeam (fionn-choill in Irish), is a species of whitebeam endemic to Ireland. It occurs in most counties, usually as scattered individuals, or in small groups.Rich, T.C.G., Houston, L., Robertson, A. and Proctor, M.C.F., 2010. Whitebeams, Rowans and Service trees of Britain and Ireland: a monograph of British and Irish'Sorbus' L. London: Botanical Society of the British Isles. It is sometimes treated as a species in the genus Aria, as Aria hibernica. The IUCN has currently listed this species as a Vulnerable species. Its population is currently stable.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Leaf size3 162 mm²

Plant height6 m

Seed mass14.98 mg

Seed mass max14.98 mg

Seed mass min14.98 mg

Life cycle & reproduction3

Deciduousnessaestival

Life formtree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aria hibernica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences9

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX167334.1 ↗403 bpUnited Kingdom · 2006

ACGT

CCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCCGCGTC …

Aria hibernica voucher NMW888 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Aria hibernica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 535 460 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aria hibernica1.54 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type10 records

Wild obs. + sensor5

Museum / vouchered5

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA4 detections

Where the DNA of Aria hibernica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Trinity College Botanical Gardens, Growing i…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 11.7–13.9

Seasonal swing summer↔winter9.70 °C

Max temp (day)16.1 °C 14.0–16.5

Min temp (night)10.2 °C 9.10–11.0

Precipitation75.7 mm/mo 73.2–79.2

Air humidity62.4 % 62.0–63.8

Moisture balance-36.1 mm/mo -42.2–-7.80

Vapour deficit560 Pa 507–602

Wind speed4.70 m/s 3.40–5.70

Cloud cover48.9 % 45.8–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)