Aria eminens

(E.F.Warb.) Sennikov & Kurtto · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Aria

At a glance

Occurrence records4

Data sources9

Biological traits12

DNA specimens0

eDNA detections4

Sources9 archives

Databases and archives Aria eminens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources12 traits

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT1.5 Gbp

01Narrative

Sorbus eminens, the round-leaved whitebeam, sometimes classified as Aria eminens when the Aria subgenus of Sorbus is elevated to full genus, is a species of plant in the family Rosaceae. It is endemic to Great Britain. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology3

Leaf size3 162 mm²

Plant height6 m

Seed mass21.82 mg

Life cycle & reproduction4

Deciduousnessaestival

Dispersal typeanimal

Life formtree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aria eminens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJN892543.1 ↗458 bpUnited Kingdom · 2003

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATCAAACCAAAGATACTGATATTTTGGCAGC …

Sorbus eminens isolate NMW732 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aria eminens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 481 181 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aria eminens1.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidy4× tetraploid · measured

Chromosome records34–682n range68median68mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 685×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea +2

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Warburg, 1952

CCDB · book-atlas-flowering-plants — Warburg 1952

CCDB · kew — Pellicer J, Clermont S, Houston L, Rich TCG, Fay MF. 2012. Cytotype diversity in the Sorbus complex (Rosaceae) in Britain: sorting out the puzzle. Annals of Botany 110: 1185-1193

2n 341×CCDB · brit-fl

CCDB · brit-fl — McAllister, H. Pers.comm. to R.J.Gornall : 8.x (1992)

2n 511×GoaT · DTOL Flowering Plants Estimates Kew

GoaT · DTOL Flowering Plants Estimates Kew

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 records

Wild obs. + sensor2

Museum / vouchered2

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA4 detections

Where the DNA of Aria eminens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 10.9–16.1

Seasonal swing summer↔winter11.7 °C

Max temp (day)16.5 °C 13.7–19.5

Min temp (night)9.00 °C 7.50–12.0

Precipitation80.7 mm/mo 72.8–121

Air humidity64.6 % 61.6–68.4

Moisture balance-9.90 mm/mo -20.4–54.1

Vapour deficit534 Pa 412–704

Wind speed4.70 m/s 3.30–6.00

Cloud cover48.2 % 45.2–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)