Argyrotome prospectata

(Snellen, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Argyrotome

At a glance

Occurrence records245

Data sources6

Biological traits0

DNA specimens128

eDNA detections123

Sources6 archives

Databases and archives Argyrotome prospectata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI123 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics128 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF245 records

Environmental DNA1 datasets · 4 countries123 detections

DNA & barcodingBOLD128 specimens

01Narrative

Argyrotome prospectata is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Snellen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding128 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotome prospectata has left across the world's sequence archives.

At a glance

DNA specimens128

BINs5

Marker genes1

eDNA detections123

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus126 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

82Cmostly conserved

88Tmostly conserved

100Gmostly conserved

115Cmostly conserved

136Cmostly conserved

202Amostly conserved

235Tvariable

238Cmostly conserved

266Tmostly conserved

316Gmostly conserved

340Cmostly conserved

343Cmostly conserved

364Amostly conserved

379Amostly conserved

403Gmostly conserved

412Amostly conserved

481Gmostly conserved

607Cmostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAACCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes8

BINs5

Most divergent pair7.8%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotome melaesame genus6.2%Capusa senilissame family6.8%Capusa stenopharasame family7.4%Perissopteryx ochreobarbipessame family7.8%Lyssa menoetiussame order7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type245 records

Wild obs. + sensor105

Museum / vouchered140

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 34≤1 km 13≤10 km 1

48 georeferenced · 57 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Uniwersytet Jagiellońskilocation not on record	75
National Biodiversity Institute, Costa Ricalocation not on record	55
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
ZSMlocation not on record	1
Universidad de Sucre (UniSucre)location not on record	1
Bavarian State Collection of Zoologylocation not on record	1

6 institutions · 134 of 140 vouchered records shown · 6 without an institution code

09Environmental DNA123 detections

Where the DNA of Argyrotome prospectata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found123

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 123 detections have coordinates

Open the map4 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland | 1.9. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.7–24.9

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.2 °C 26.4–27.7

Min temp (night)21.7 °C 20.9–23.4

Precipitation313 mm/mo 138–412

Air humidity69.5 % 65.6–70.9

Moisture balance166 mm/mo 24.5–275

Vapour deficit916 Pa 748–950

Wind speed2.90 m/s 2.40–3.80

Cloud cover39.1 % 30.6–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 122 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)