Argyrostrotis quadrifilaris

Hübner, 1831 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Argyrostrotis

At a glance

Occurrence records434

Data sources7

Biological traits0

DNA specimens48

eDNA detections49

Sources7 archives

Databases and archives Argyrostrotis quadrifilaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility434 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF434 records

Environmental DNA1 datasets · 1 countries49 detections

DNA & barcodingBOLD48 specimens

01Narrative

Argyrostrotis quadrifilaris, the four-lined chocolate moth, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1831. It is found in the US from New York and New Hampshire south to Florida and Texas. The wingspan is about 27 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrostrotis quadrifilaris has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

eDNA detections49

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes12

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gondysia similissame family4.1%Cutina albopunctellasame family5.2%Achaea chrysoperasame family5.2%Achaea atrimaculasame family5.2%Bastilla hercodessame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type434 records

Wild obs. + sensor326

Museum / vouchered108

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 114≤1 km 71≤10 km 27>10 km 20

232 georeferenced · 94 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 14≤10 km 28>10 km 9

51 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	42
Mississippi State, US	7
Georgia Museum of Natural Historylocation not on record	4
CUlocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
St. Paul, US	3
Colorado State Universitylocation not on record	2
East Lansing, US	2
Cornell University Insect Collectionlocation not on record	2

9 institutions · 68 of 108 vouchered records shown · 40 without an institution code

09Environmental DNA49 detections

Where the DNA of Argyrostrotis quadrifilaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map1 country0

MVL & UV LED sheets at edge of open grassy a…Scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 22.8–27.1

Seasonal swing summer↔winter10.8 °C

Max temp (day)31.8 °C 28.3–31.8

Min temp (night)23.0 °C 18.3–23.0

Precipitation225 mm/mo 88.2–238

Air humidity61.6 % 56.9–62.1

Moisture balance58.5 mm/mo -96.3–73.2

Vapour deficit1,371 Pa 1,138–1,395

Wind speed2.10 m/s 2.10–3.70

Cloud cover32.8 % 29.6–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)