Argyrosticta vauaurea

Hampson, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Argyrosticta

At a glance

Occurrence records211

Data sources5

Biological traits0

DNA specimens48

eDNA detections42

Sources5 archives

Databases and archives Argyrosticta vauaurea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility211 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF211 records

Environmental DNA1 datasets · 3 countries42 detections

DNA & barcodingBOLD48 specimens

01Narrative

Argyrosticta vauaurea is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1908 door Hampson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrosticta vauaurea has left across the world's sequence archives.

At a glance

DNA specimens48

BINs4

Marker genes1

eDNA detections42

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

16Tmostly conserved

56Cmostly conserved

67Gmostly conserved

70Amostly conserved

82Tmostly conserved

88Amostly conserved

91Cmostly conserved

139Amostly conserved

143Gmostly conserved

163Amostly conserved

202Cmostly conserved

208Gmostly conserved

226Tmostly conserved

343Cmostly conserved

361Tmostly conserved

364Cmostly conserved

376Tmostly conserved

400Amostly conserved

433Amostly conserved

436Tmostly conserved

457Cmostly conserved

526Tmostly conserved

548Cmostly conserved

553Tmostly conserved

586Tmostly conserved

616Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACCTCATTAAGACTATTAATTCGGGCAGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes8

BINs4

Most divergent pair8.5%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrosticta meressame genus7.1%Chalcopasta howardisame family7.6%Catocala optimasame order8.1%Condica dolorosasame family8.1%Condica punctiferasame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type211 records

Wild obs. + sensor57

Museum / vouchered154

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 29≤1 km 1>10 km 3

33 georeferenced · 24 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 154 records without

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	121
Mississippi State, US	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
The University of the West Indies, Trinidad and Tobagolocation not on record	7
Area de Conservacion Guanacastelocation not on record	1
University of Pennsylvanialocation not on record	1
ZSMlocation not on record	1

7 institutions · 147 of 154 vouchered records shown · 7 without an institution code

09Environmental DNA42 detections

Where the DNA of Argyrosticta vauaurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 21.5–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C 25.2–27.5

Min temp (night)21.9 °C 18.1–24.2

Precipitation391 mm/mo 228–468

Air humidity71.2 % 68.8–76.4

Moisture balance241 mm/mo 105–334

Vapour deficit893 Pa 700–966

Wind speed2.00 m/s 1.30–3.30

Cloud cover33.8 % 24.2–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)