Argyrosticta bellinita

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Argyrosticta

At a glance

Occurrence records10

Data sources5

Biological traits0

DNA specimens92

eDNA detections93

Sources5 archives

Databases and archives Argyrosticta bellinita's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 2 countries93 detections

DNA & barcodingBOLD92 specimens

01Narrative

Argyrosticta bellinita is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Guenée.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrosticta bellinita has left across the world's sequence archives.

At a glance

DNA specimens92

BINs2

Marker genes1

eDNA detections93

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus90 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

352Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes5

BINs2

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrosticta eubotessame genus4.9%Chaograptis euchrysasame family5.9%Lacera uniformissame order6.8%Ophyx ochropterasame order7.3%Ceromacra tymbersame order7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor5

Museum / vouchered5

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 3 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Pennsylvanialocation not on record	2
Ciudad de México, MX	2

2 institutions · 4 of 5 vouchered records shown · 1 without an institution code

09Environmental DNA93 detections

Where the DNA of Argyrosticta bellinita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.0–25.1

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C 25.6–28.2

Min temp (night)21.8 °C 20.7–22.4

Precipitation325 mm/mo 63.4–478

Air humidity73.3 % 65.5–75.5

Moisture balance179 mm/mo -99.3–344

Vapour deficit752 Pa 717–1,051

Wind speed1.60 m/s 1.00–2.90

Cloud cover31.5 % 13.6–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)