Argyrosticta aurifundens

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Argyrosticta

At a glance

Occurrence records111

Data sources5

Biological traits0

DNA specimens33

eDNA detections31

Sources5 archives

Databases and archives Argyrosticta aurifundens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF111 records

Environmental DNA1 datasets · 1 countries31 detections

DNA & barcodingBOLD33 specimens

01Narrative

Argyrosticta aurifundens is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1858 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrosticta aurifundens has left across the world's sequence archives.

At a glance

DNA specimens33

BINs2

Marker genes1

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

5Cmostly conserved

22Tmostly conserved

31Tmostly conserved

34Amostly conserved

43Amostly conserved

70Amostly conserved

79Amostly conserved

82Cmostly conserved

85Amostly conserved

91Tmostly conserved

100Amostly conserved

127Cmostly conserved

130Amostly conserved

184Tmostly conserved

205Amostly conserved

206Cmostly conserved

232Amostly conserved

235Tmostly conserved

238Tmostly conserved

268Amostly conserved

271Tvariable

274Amostly conserved

277Amostly conserved

287Cmostly conserved

298Tmostly conserved

334Tmostly conserved

337Cmostly conserved

346Cmostly conserved

352Amostly conserved

364Cmostly conserved

382Amostly conserved

385Cmostly conserved

386Cmostly conserved

391Tmostly conserved

397Cmostly conserved

412Amostly conserved

415Tmostly conserved

421Tmostly conserved

433Amostly conserved

454Amostly conserved

463Cmostly conserved

477Gmostly conserved

478Amostly conserved

479Tmostly conserved

514Amostly conserved

520Amostly conserved

533Cmostly conserved

535Tmostly conserved

536Cmostly conserved

538Tmostly conserved

547Tmostly conserved

556Amostly conserved

565Amostly conserved

568Amostly conserved

571Tmostly conserved

574Amostly conserved

581Cmostly conserved

586Tmostly conserved

589Cmostly conserved

592Tmostly conserved

616Tmostly conserved

619Amostly conserved

628Amostly conserved

640Cmostly conserved

641Cmostly conserved

658Tmostly conserved

AACACTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes7

BINs2

Most divergent pair10.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrosticta meressame genus5.9%Condica punctiferasame family7.8%Protogygia polingisame family8.1%Protogygia biclavissame family8.2%Homorthodes communissame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor4

Museum / vouchered107

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	94
Tapachula, MX	6
Ciudad de México, MX	4
PUC-RSlocation not on record	3

4 institutions · 107 of 107 vouchered records shown

09Environmental DNA31 detections

Where the DNA of Argyrosticta aurifundens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.0–25.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.8 °C 25.8–28.2

Min temp (night)21.9 °C 20.6–22.4

Precipitation325 mm/mo 83.3–468

Air humidity70.5 % 68.0–75.5

Moisture balance167 mm/mo -44.1–334

Vapour deficit863 Pa 730–1,003

Wind speed1.40 m/s 1.20–2.40

Cloud cover30.5 % 15.1–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)