Argyrosomus coronus

Griffiths & Heemstra, 1995 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Sciaenidae/Argyrosomus

At a glance

Occurrence records44

Data sources7

Biological traits8

DNA specimens6

eDNA detections0

Sources7 archives

Databases and archives Argyrosomus coronus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

OBISOcean Biodiversity Information System19 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS44 records

DNA & barcodingBOLD6 specimens

01Narrative

Argyrosomus coronus is een straalvinnige vissensoort uit de familie van ombervissen (Sciaenidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1995 door Graham C. D. Griffiths en Phillip Clarence Heemstra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length200 cm

Body mass77 000 g

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits2

Depth max100 m

Vulnerability90

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrosomus coronus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

27Cmostly conserved

31Avariable

88Amostly conserved

211Cmostly conserved

214Avariable

325Gmostly conserved

439Cvariable

CCTTTACCTAGTTTTTGGTGCATGAGCCGGAATAGTAGGCACAGCCTTGAGCCTCCTAATCCGAGCAGAACTAAGTCAGCCCGGCTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes4

BIN1

Most divergent pair0.77%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrosomus japonicussame genus3.4%Argyrosomus hololepidotussame genus3.8%Argyrosomus inodorussame genus4.0%Argyrosomus regiussame genus4.1%Argyrosomus thorpeisame genus5.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor1

Museum / vouchered43

Range

Area of Occupancy AOO44 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 1 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	19
Museu Nacional de História Natural e da Ciêncialocation not on record	5

2 institutions · 24 of 43 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)